Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15061  (registered. 2012)
Contig Information
Length 952 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224031501|gb|ACN34826.1|| unknown [Zea mays]
Score 475
Evalue 4.00E-132
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15061
AACAGCCCATTCTATAACGAGTTACAAACATGAGAAGCAGCATACAAGATACAACTAAGACAACCACAAATCGCAAACCTGCCTTTTGTTAGATAGTACC
TCCTTGTCATGTGGTTATCTGAACCATCCTGTTCTCTATAAAATCTAGCAACAGAATGTAAAAGTCGACAAACAACAGTCACTATTTTACAAGTCATTTC
CAGAGCTTGACAAGCCTGTCATGACTAACTGAGGCAACCTTGCCTGTTGCGCTCGATGCTGCTAGGGCTGCAATTAAACCGTCATGAGCATTGTTCAAGG
TCATGGCATTCTTCTCCCTGATGTCCCAAAGTTCCAAGGACTCATAACAACCAATGACTAGCAAAGAAGGGTGAGCTGGATGGAAAACACATGTTTGAAA
CTTGTTCCCACTGCAGTTCAACTCATTCACAAATTCACCATCCTGCCCAGAAGTAAATGACCATATTCTGACAGCATCTTCACTAACAGAAGCAAGATAG
TCACCCGCAGAGTCCCAACAAACTGACTGAATGTCCTTTGTATGACCCTGTAAAGGGCTTCTACAAGCATGCTGTGTCTCCCCATCAAGTATGTAGATAG
CCTTCTCTGATGCAGCTGCTAGATATTTTCCTTTGCGGGGTTGAAATCTCATCTGAGTGGCACCTCCCTTAAAAACCTTGACACAGGTCAGGCAGCTACC
ATTGTTAATGCTCCAACTGCGGACTTCCCCATCACTATCACAGGAGCAAATAATATCTTCTTTATTGGGGTGAAAATCAAGTGACATCACAGATGCTGAA
TGACCCGTGAAAGTACGGAGCGAATAGTCAGTATTGTCAGCATCCCAAACCCGTACGGTTTTGTCAAAGGAAGATGTAGCAAGGCGGGACATGCTTGGGC
TAAATCGAACATCGGTTATCAAAAATGAATGCTCTTCTAACGAGGATTTAGG
page-top