Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15060  (registered. 2012)
Contig Information
Length 508 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242074960|ref|XP_002447416.1|| hypothetical protein SORBIDRAFT_06g000740 [Sorghum bicolor]
Score 200
Evalue 4.00E-50
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15060
GCTCGCGGCCCGGTCGCCGGTCTTCAATGCGGATTTCTTTGGCGCAATGAAGGAGAGCGATGTCGCCGCCGGCGTGGTCCACATCGGCGACATGGAGGCA
CAGGTGTTCAAGGCCTTCCTCGTCTTCATGTACACCTACTCGCTGCCGGAGATGGCAAAGGAGGAGGAAGACGCCATGTACCAGCATCTCCTTGTGGCCG
CGGACAGGTATAACATGAAGAGGCTCTAGTTGATTTGCGAAGACAAGCTGTGCAAGAGAATTGATGGGAACACTGTGGCCAACGTGTTGGCGTTGGCTGA
GCTTCACCACTGCCGTGATCTCAAGGACGCGTGCTTCGAATTTCTCAGCACTCCTGCAAATCTTAGGGAGGCCATGGCCACTGACGGCTTCGAGTATCTT
AGCGCAAGCTGCCCTTCTGTTGTCAAGGAGCTGATTGCCATGTGCTCCGCTCCTTAGTCCAGTCTCCAGTGATACTGATCGATGGGCTCCTGTGTCTGGA
GGGGATGC
page-top