Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1506  (registered. 2012)
Contig Information
Length 1471 bp
Clones alternative view 527 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 12
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 11
Wh_f Spike at flowering date 10
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 9
Wh_r Root 1
Wh_yd Spikelet at late flowering 14
Wh_SH - 1
Wh_CSEC Callus 48
Wh_DPA20 Seed DPA20 9
Wh_EM Dormant seed with water absorption 10
Wh_EMI Dormant seed with water absorption after breaking 14
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 26
Wh_KMV Shoot grown with continuous light after cold treatment 13
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 18
Wh_PCDAM Anther at meiosis 5
Wh_RDr Root of dessiccated seed 5
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 8
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 13
Wh_VWD Shoot grown with dessication 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 6
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 8
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 11
WH_XN Leaves, plant was grown at constant 23Ž 7
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 15
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
WH_XR Roots, 18 day old plants were grown hydroponically 26
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 19
WH_XT Roots, 18 day old plants were grown hydroponically 11
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 11
WH_SP 3
WH_XA Root 8
WH_XB Root 20
WH_XC Root, treated at 50 microM Al for 6h 13
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XE Seedling, infected with leaf rust 9
WH_XF Seedling, infected with leaf rust 14
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 16
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 22
WH_XV Leaves, plant was grown at constant 23Ž 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|4325045|gb|AAD17232.1|| S-adenosylmethionine decarboxylase precursor [Triticum aestivum]
Score 649
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1506
ACGAAAAACGTTACTACTACACCCAATAACTCACGAGGCCGGCACTGACACCTTGAATGAATTATTGGAGTGGTTGCACGAATCAGAAATGCAGAAGATA
GGATCAGAAACAAGGAAGATAAGGATGAAGAATCAAATAGTTCTCTTCAATCGAAGAAAAGAATCAATTCGTGCTTGTATTCCTCGCGCAGTAGTTTATT
CCTGCGCGTACGAGATGATCAGAAGATAGGCCAGGGGAAATGAGCACACTGGTCGCTTGTCAACACACTGCAACTTGGCACAGAGTAATTTTTTTTATAA
CAAAATGATTTTTTTTATAGGAAAAATAATGCTTATTTATAAGTTCGAGACAGCTTTTCCCCAGAAGTACGCTCATTGTGGCAGACGCAGCAAACCACCT
AGAGCTAATAGTTTATTCAGAGAGCAATAGCCTGGCCGGCTGCTTCACAGTAACCAAACGACAAACTGACAGTCAGAACAAATTCCACAGATGGAATAGC
GACAGCAAATCATGTCTTCACTCGCACAGCACCGCGCCCTCTTCCAGAGAATCCTCCTCCGCCCGCCATGCGAGGAGGTTGGCGAGCTTGCCTTCCTTGA
CCAGAGGGTGGCTGTGCACACTCTCGGCCTCGAAGCAGTGGAAGACGGACCTGGGCGACCCGGCAGAGACAGCAACCTCTTCGTTCACGGTAAAGCTCTG
GTAGATGAGGACGCCTCCACAGGGGAGCTCCTGCTCCACAACGTTGTTGCAGTCGTATGCCTCGGCGTCGAGCTTCTTGCCCCAGGTGGCGGCGTGGCCG
CGGCCACCAAAGATGGTGACCGCCGCAGAGAACTCTGAAGGGCCAAAGCACCGGAGGACCCTCTTGACGATGTCGCCGTAGGCCAGGGCGGAGGCGTCCA
TGCCCATGACCTCGTAGCTCGCATAGCTGAAGCCGTCCTCGGGGGTCACATGGATGGTGGAGACGGCAGATCCGTTGATGGCGTTCATGGAGTAGCCGCA
GGGCTCGAAGTCGAAGTCACAGACCTCCATCTCGGGAATGATGTCGGAGATACCAGAGAGCTTGGTCATCTCCTTGGCGCAGGAAACGTGGCTATCAGCT
TGAGTCTTGAAGAAGACAGAGGCCTTCTTCTTGTCCAGCCCAGTCATGCACATCTCCAGGGTGACCATGGGCTGCTCAGGTTGCTCGGTGGCATAGTAGA
TGTGCCACTTCTGGCCAGGCTTCGCTGGGTCTCCGATCACATAAGCATTGCCGCCAGACTTCAGGTGGCCGAAGTAGCGGTTCAGGACATCAACCTCCTC
AGAGAAGCTCCTGTGGGGAGCAGGCTGTGCGCCGGGGAAGATGAACATCCCACGAGAGTACTTCACGGCAGCAAGCGGCATGCACAGCTCTTCAGCAAGC
TCAAGAATCCTAGGAATGGTGAGCAGGAGCATGGTAGTCCCACAGGTCTTGATCACAATCTTCTGAGAGTA
page-top