Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15054  (registered. 2012)
Contig Information
Length 1082 bp
Clones alternative view 80 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 5
Wh_SHDr Shoot grown with dessication 4
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 9
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 8
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 7
WH_XN Leaves, plant was grown at constant 23 5
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 5
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108707532|gb|ABF95327.1|| IN2-1 protein, putative, expressed [Oryza sativa (japonica"
Score 442
Evalue 4.00E-122
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15054
ATCGCCGCCTCATCGCCGCCAGGAGTTCGAGCTCCCCCCGAACCGTCGCCATGGCCGCCGCCGCTGCCGCTGCCGCACCGGTCATCTCCCCGAAAGAAAA
TCTGCCCCCTTCGCTGACCTCCACCTCCGAGCCCCCTCCACTCTTCGACGGCACCACCAGGTTGTATGTTGCATATCACTGCCCGTATGCGCAGCGCGCT
TGGATTGCCAGGAACTACAAGGGTTTGCAAGACAAGATCAAGATAATCGGGATCGATCTCGCAGACAGGCCGGCTTGGTACAAGGAGAAGGTTTACCCAC
AGAACAAGGTGCCTTCACTGGAGCATAACAACGAGGTGAAAGGAGAAAGCTTGGATTTGGTCAAGTACATTGACAGCAATTTCGATGGCCCAGCATTGCT
CCCTGATGATTCTGCAAAGAAGCAGTTTGCCGAGGAGCTGCTTGTGTACACCGACGAGTCCAATAAAGCACTATACTCATCCATAACCTCCAAGGGAGAT
GTGGCAGAGGAAACTGTTGCTGCGCTGGATAAAATAGAAGCGGCCCTGGGAAAGTTCAGTGATGGACCTTTCTTCCTTGGCCAGTTCAGTTTGGTGGACA
TTGCATATGTGCCATTTATCGAAAGGTTTCAGATATTCTTTTCTGGTATCAAAAACTATGATATCACCAAGGACAGACCTAACATTCAGAAATTCATCGA
GGAAGTGAACAAGATCGATGCGTACACGCAAACGAAACTGGACCCACAATTTCTGCTTGAACACACAAAGAAGCGGCTTGGGATTGAGTGAAGATGTGAC
CAAGGATGACCAAGAGGCCAGGGAACTACTGCAGCATGGAAGATGAAGATGAAGACACTCAGGAGTGTGCTTGCTTGCTAGTACTATATACTATACTTTG
AATAAAAAGATGCATGCTACTAAGGCCCTGCCTTTTGAGAATAAATTAAGTGGTTGTTTTGTGATTATAGTCTTTTTAGGCGTTCTGTGATTGTGGTTTG
ACAGTGTACAATATTGTGAGTATGTACGTGCAATTAATATACTGCCTAATATCAATTATCCTAGTACCTAGTAAAAAAAAAA
page-top