Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15046  (registered. 2012)
Contig Information
Length 1956 bp
Clones alternative view 85 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 13
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 3
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 7
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 5
WH_XA Root 5
WH_XB Root 11
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|6136111|sp|Q43772.1|UGPA_HORVU|UGPA_HORVU RecName: Full=UTP--glucose-1-phosphate uridylyltransferase; AltName:
Score 922
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15046
GGAGCCGCATCGCCTCACACCGCCACCTCTCCCTTCCAGTCATCTGACATCTGCTCCCGTCCTCTCCTCTTCTCTTCCCCCCGAAGCAGCAGCGTCCCTC
CTCTCCGCCCGGATCGCGATGGCCGCCGCCGCCGTCGCCGCCGACTCCAAGATCGACAACCTCCGCGACGCCGTCGCCAAGCTCGGCGAGATCAGCGAGA
ACGAGAAGGCCGGCTTCATCAGCCTCGTCTCGCGCTACCTCAGCGGCGAGGCGGAGCAGATCGAGTGGAGCAAGATCCAGACCCCCACCGATGAGGTGGT
GGTGCCCTACGACACCCTCGCGCCCCCTCCCGAAGATCTCGACGCCATGAAGGCTCTGCTCGACAAGCTCGTGGTGCTCAAGCTCAACGGAGGCCTCGGC
ACCACCATGGGCTGCACCGGCCCCAAGTCCGTCATTGAAGTTCGCAATGGGTTTACATTTCTTGACCTTATTGTGATTCAGATTGAGTCCCTGAACAAGA
AGTATGGATGCAGTGTTCCTTTGCTTCTAATGAACTCTTTCAACACTCATGACGACACACAGAAGATTGTTGAGAAGTACTCCAACTCCAACATTGAAAT
TCACACTTTCAACCAGAGCCAATACCCTCGCATTGTTACTGAAGACTTCTTGCCACTTCCAAGCAAAGGGCAGACAGGGAAGGATGGCTGGTACCCCCCA
GGCCACGGTGATGTGTTCCCCTCTTTGAACAACAGTGGAAAACTCGATACCTTACTGTCACAGGGAAAGGAGTATGTCTTCGTGGCGAACTCAGACAACT
TGGGTGCTATAGTTGACATCAAGATACTAAACCACCTGATCACTAACCAGAATGAGTACTGCATGGAAGTTACTCCAAAAACATTGGCTGATGTCAAAGG
TGGTACCCTCATCTCATACGAAGGAAGAGTCCAGCTCTTGGAGATTGCCCAAGTCCCTGATGAGCATGTGAATGAATTCAAGTCGATTGAGAAGTTCAAG
ATATTTAACACCAATAACCTGTGGGTGAACTTGAAGGCGATCAAGAGGCTTGTAGATGCTGAAGCACTTAAGATGGAAATCATTCCCAACCCTAAGGAAG
TTGATGGCGTGAAAGTCCTGCAGCTAGAAACCGCAGCTGGAGCAGCGATCAGGTTCTTTGAGAAAGCAATCGGCATCAACGTTCCCCGCTCAAGGTTTCT
GCCCGTGAAGGCTACATCTGATTTGTTGCTTGTGCAGTCTGATCTCTATACCTTGGTTGATGGCTACGTCATCCGCAACCCAGCCAGAGTGAAGCCATCG
AACCCTTCAATTGAGCTTGGTCCTGAGTTCAAAAAGGTTGCCAACTTCCTTGCCCGTTTCAAGTCGATCCCCAGCATCGTTGAGCTCGACAGCTTGAAGG
TCTCTGGTGATGTCTCGTTTGGCTCTGGAGTCGTACTCAAGGGCAACGTGACCATCGCTGCCAAGGCTGGAGTCAAGTTGGAGATCCCAGACGGAGCTGT
GCTCGAGAACAAGGACATCAACGGCCCTGAGGATCTTTGAGCGACGCCCGCCGCCATCGCCAGTCGCATTCCCAGAAACCTTCCGGTCCTCCTTCGCTGA
GTTAACCGTCCTGTAATTTTCGTGTGCATTCTGCTGGGGTGTTGTCCTGGGATAGCCCCTTTACATAATAATTGTAATCCCCTCTGTGATGTTCATCTAC
ACTTGTTCTTCCTGGGTGTGCCAGGGACGTAAAATTTCTTTTGGTTATATGATGCCCATAGTTTTCACATGCCTAAATTTGTTTCTTCTTTCGCCCTGCT
GGGCTGTAAGAGTTGCTTTTTGCTAGAGTATTTTGTGTCTCCTTTGGCAGTTGTGCCATGCGTAATCCACACTTGGTTGTGGCCATTTTAGATCACAAAG
ATACCGTCTATTGACAATCTTTCTCGTGGAACCTGAATTGTTTGCTTCTATGCTCC
page-top