Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15  (registered. 2012)
Contig Information
Length 778 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig15
AAGTTAAATTGGCCTGTACATGATTGTAAACAATTTGAACTATGCACAAGACTGCCTTCTGTAAGAATTTGAAGCCAAAAAATTGCAAAGGGCGTAACTA
GGTGAGCCTGTTGCACAGCCGTTCCGCTATCAACAAGAACGTTGTGCAGGATTGCAGCTCCATAGTCACATCGCAGAAGCAACTCTCCCCATCTAGCTAT
CCACAGAATGGTGGCAGCCAATATTGCCGTACAACAGCTACCCGTCAGCTTGCATCGACTGCGATACTGCTCTAGGACAATCAGGATTACACCAGGCCAT
CAAATCAAATCACTTTTCTCGAACTGGGGACACACCGAATAATCTTGGCCCATGCAGGGACAACCAAGATTGCACAAAGCCACCAGTCACCTTGCAATCT
TGTACTGTAGCATCATGAATGCGTTTGGTGTCGGTCAAAATGTTTGGAAAGGCAACACTGCTTTCACCTGACCATAGGAAAGATTATATCCAGGACAGGT
AGATAAAAAGTCTGATATCGATTGATCCTTTGGAATAGCAAACCTGAACAAAATTCACTAACGAGCAGATTGCCAATCAACTCCAGATTGTAGGATTTTT
GAACTGTAAAGATATTGCTTCAGACAGGAACTTCACAATTTCTTCCTTTTCAACATCTTTCTCCTTTCTTGCATCGAGATGTCTAACCTTCACAAGATCT
GTTTGCGANNGACCTGCTTCAGTGATAAACACAAGGCATTTGATGTCATGATCACTGGCGTACTCATATTGTTCTTGA
page-top