Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14953  (registered. 2012)
Contig Information
Length 1192 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|149391395|gb|ABR25715.1|| unknown [Oryza sativa Indica Group]
Score 345
Evalue 8.00E-93
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14953
CCTGCCATGGACATCTTTTTGCAGAAGGCATCAGAAAAATCAGCACACGCAAAGAAATGGGCTGAACCACATATCGAGACCGCGAAGCTGAAATTGGTTC
CTGTTAAGGAGAAACTGGCTGTGCTAAAGAAAAACGCAGAACCTTACGTGGAGAAGGCGTCGGCAAAATCAGTGGAAGTTTATGAAGCATCCAGGGATGC
TATTACACCCCACTTTGTAAAATTTAAAGAAGTTTCTGATCCCTACTTCCAGGAAGCTAAGAAGATCTCTAAACCTTACATTGATCAAGTTGCTGAGGTC
ACGAAGCCACATGTTGAGAAAGTTAGGAGTACTCTTAAGCCTTATACTAAAAGAGCAGTTCATGTGTATGGAACATTTCTCGAGTCTGCGACTACATACC
ATCGACAGGCTCAAGCAACCATTTCAGATTACTTGCACCAACATGAAATAACAAAATCACTTGTGACTAAGGAGTTGGTTTGGTTCCTGGCTTCTGCTTT
GCTGGCTCTACCTGTGTTTATTATGTACAGGCTTCTAGTAGAAACCTTCTGCATGAAGAAGCAGAAGAGATCGCCTCGTAATGGTAACGGAAACAATGGC
AATAGGAGACACAAGCGCCGACATGCTGAGAAGTAAACCATCGTCGGCTGCCATGTAGGGTTGCAGAAATCAGAGCATGCTCTTCCCTGATGAGGCTGTG
CTCTCTTGTCCATGGTAGAAGGATGGAACGCTGTACACCACCAGATTTTTTCGTTTTCCTTTTGCCCCCTATTGTATGGACTATAGTTTCAGCAGCGGCC
TTATGTATCTGCATCTTGCCGAGGTTTAATATGGGCTTAAACCTCGGCGTTTGTTAATTGTTTATTGTAACTTTGTTAATACGCTTGAGTTTGTTTGCAT
CGTGCTTGCTAGTTTTTGTTCTTGCTCACCGGCATCCTAATTATACGATATACGGTTGTTCTACAATTTATGTAATTAATCGTACATGCTATGATTTGGT
GAGAGACTGCAATCAACGTTGAGCTATGAATTGGTTTCTTGCCAGGAGAATAAGATCCGGCGTCAGTTTGGGGATGTCGACAAAAGGCTTGCTCGAGTCT
AATACTCGAATAGAACGTGCCATATCCGTGCAAAAGAAATAAAGAGTGAAGTGAATGGATTCTGAGAATTTTCAACTTGCTCAAAAAAAAAA
page-top