Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14922  (registered. 2012)
Contig Information
Length 908 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|62765876|gb|AAX99161.1|| 2-alkenal reductase [Hordeum vulgare subsp. vulgare]
Score 413
Evalue 2.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14922
TTTTTTTTTTGACCAGAGTGCGGGATGAGCAGCATCAACTTCCCTTTTTAAAAATGCTAAAGATTATACAGTAGTTCATTCCAACTTCCTGGTTCACCTA
AGTAGGATTCTGTTTTCTCCAACTTTCTGAAAACACTGTCTCAAAGCATGCTGAATCCAGCAAACCGGACTAAGTACCTCTCCATATATATCTGAATTCT
GGTCTCTGAACGCACATCAGTACTTCTCGATCCAGGAGGGCTCCTGGCATGCGACGTCACTCTCGTGCGACGGCCACCAGCTGCTTTCCGATGTTGCGCC
CGTAGAAGAGCCCGATGAGCGCAGATGGGAAGCTCTCGATCCCCTCGGCAACGTCCTCCACGTAGGTGATCTTCCCTTCCTTGAGGTAGCCGGCCATCTC
CTCTTCGAACTTTCTGTAGCTGCCGTAGTGATCCATCACGATGAACCCCTCCATGCGGATGCGCTTGGCGACGATGCTGAAGAGGTTGTGCACGCCCTCG
AGCTGCTCCAGGTTGTACTGCGAGATCATCCCGCACACCGACACCCGCCCGTGCAGCCTCATGTTGAGAAGCACCGCATCCAGCATTGCACCACCCACGT
TCTCGAAGTAGATGTCAATGCCCTCCGGGAAGCACCTCTTCAGTGTGGCGTTCAGGTCCTGCTCCTTCTTGTAGTTGAAGGCATCGTCAAACCCAAACTT
TGTTTTTAGGAGGTTGACCTTCTCATCAGAACCGGCACTACCAACCACATAGCAGCCAGAGATTTTGGCAAGCTGCCCGACAAGCTGCCCGACAGCACCT
GACGCTGCTGACACGAAGNCATAGTCGCCCTTCTTTGGCTTGGCCACGTCAAAAAATCCAGCNNNNNNNGTAAGACCAGGCATGCCAAGTACTCCTGTGT
AGTATGAC
page-top