Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1491  (registered. 2012)
Contig Information
Length 809 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|119388721|gb|ABL74257.1|| alcohol dehydrogenase ADH2H [Triticum aestivum]
Score 437
Evalue 5.00E-121
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1491
TGGGTTTCCGCAAATTAATCGAGCAACCTTCTTCTGTTTATTTCATGAACCGGAGTCCTAAGGGGCGTGGCTTAAAAAAAAGGTAAGCAAAGAGGTAATA
CATGTGTGTTGTAGTGCAATAGCAGCGAGGGATGAAGAAGAGCCAGGTGCTCTACTCTACTCATCCATCCTGATGACGCAGCGCAGGCCTTCCCCCTTGA
GCATGAGGTCGAAGGCCGTGTTGATCTGCGAGAAGGGCACGCTGTGGGTGATGAACTTGTCCAGCTCCAGCTCCTTCCTCATGTACATGTCGACGACGCC
TGGGAGGTCGGTGCGCGGCTTGTAGTTGCCGAAGAAGGTGCCCCTCAGCGTCCTCTCGTTGAGGAAGTTCATGGGGTGGGTCTTGAACACCGCCTCCTTG
TGCGCCACGCCCACCAGCACCGCCACGCCCCACCCATCGTGCACGCATTCGAAGGCGGAGATCATGGCGTCGGCGTTGCCAGTGCACTCCACCGCCCGGT
CGACTCCGCCGTCGGTCATCTCCACGATCACCTCTTGCACTGGCTTGGTGTGGTCCTTGGGGTTCACAAAGTCGGTGCAGCCAAATTTCTTAGCTTGTTC
GTGTTTTGCAGGGTTCAAGTCCACACCGATAATCCTCGATGCGCCGGACATCCTGGCCCCTTCCATGGCAGCAAGGCCAACAGCTCCAAGACCGAAAATC
GCCACTGTCATACCCTTCTTCGGCTTGGCGACGTTGAGGGTGGCACCTAGCCCGGTTGAGATACCGCAGCTAAGGAGGCAGACTTTGTCGAGGGGCGCCT
CGGGGTCGA
page-top