Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14844  (registered. 2012)
Contig Information
Length 1388 bp
Clones alternative view 32 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
WH_SP 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115443619|ref|NP_001045589.1|| Os02g0101500 [Oryza sativa (japonica cultivar-group)]
Score 736
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14844
TGTAGCTTGTCACCACAACTTGCATCTAGCTTCTTGTTTCTCCTCCTTGCAGCTGCTCCCCCCTGCTCCAGACATGGCGAAGCCGATATCGATAGAGGTG
TGGAACCCCAGCGGCAAGTACCGCGTGGTGAGCACCAAGTCCATGCCCGGCACCCGCTGGATCAAGCTCCTCACTGACAACGACTGCCGCCTCGAGATAT
GCACGGAGAAGAAGACCATCCTCTCTGTTGACGACATACTGGCACTCATCGGTGATCACTGCCATGGTGTCATCGGCCAGCTAACAGAGGACTGGGGGGA
AGTGCTCTTCTCTGCGCTCAAGCGTGCCGGCGGGACAGCCTTCAGCAACATGGCCGTCGGTTACAACAACGTTGATGTCGATGCTGCCAACAGGAATGGC
ATCGCCATCGGCAACACGCCTGGTGTTCTTACCGAGACGACGGCGGAGCTGGCGGCGTCACTGTCGGTGGCGGCTGCCCGGAGGATCGTTGAGGCCGACC
AATTCATGAGGGCTGGCCTCTACGACGGATGGCTTCCGCACTTGTTTGTTGGGAACTTGCTCAAGGGGCAGACTGTTGGAGTGATCGGAGCTGGCCGCAT
CGGCTCAGCTTATGCAAGGATGATGATTGAGGGGTTCAAGATGAACTTGATCTACTTCGATCTGTACCAGTCCACACGGCTCGAGAAATTCGTCACAGCG
TATGGCCAGTTCCTGAAAGCCAATGGTGAGCAGCCTGTGACATGGAAGAGGGCCTCCAGCATGGAGGAAGTTCTCAGGGAGGCCGATGTGATAAGCCTGC
ACCCAGTGCTGGACAAGACGACGTACCACCTGATAAACCCTGAGCGGCTGGCGATGATGAAGAAGGAGGCAGTGCTGGTGAACGCCAGCCGTGGCCCGGT
GATCGACGAGGTTGCACTGGTGGAGCACCTGAGGGCGAATCCCATGTTCCGTGTTGGCCTCGATGTTTTTGAGGATGAGCCTTACATGAAGCCAGGGCTG
GCTGAGATGAAGAATGCCGTCGTCGTGCCTCACATCGCATCTGCATCGAAGTGGACGCGTGAAGGGATGGCGACGCTCGCTGCTCTGAACGTGCTTGGTA
AGATCAAGGGGTACCCGGTGTGGGGGAACCCGAACACGGTGGAGCCCTTCCTCGACGAGAAGGCGGCGCCGCCCCCTGCCTGCCCAAGCATCGTTAACGC
CAAGCAACTCGGCCTGCCATCTTCCAAGCTTTAGGCAGAGGCAGAGGCAGAGATGGATGAATCACTGCTACTACTACTACTACTTGCTAAGATGCTATGC
ATATATAGCTCCTTCCCAGTATATATGTATGAATGCCCTCATCCTCATGGAGTAGCAGTACTGAATGAATGAATGAGTATATATATCA
page-top