Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14792  (registered. 2012)
Contig Information
Length 1129 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218186677|gb|EEC69104.1|| hypothetical protein OsI_38012 [Oryza sativa Indica Group]
Score 551
Evalue 5.00E-155
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14792
GAAAAAGCCTGACACAAAACAAGAGTGTTCTTCACCCGCCATAATGGTGAAGTTATAAAAAAATAAATCAAATTTGTGCTACATACACATGCGAATGCAT
CAATAAGAGATACATGCAGCCTCAATAACGATATTGCTGAAAATCTATTCATGCTGGAAATACAATATCTATGGACTCGGCCAACGCCTATTGTTGTAAT
GTAAGTCACAACCCAGTCACTATGCGAATGCTTGATCTAAAATTATCCGGTTCTCACACCATATTGGGCCTTTGGGGCAGAAGGAGGTTGTAGAACTTGT
CCTTCAAGAAGAAGCTCCGACCCTTGCTGTCGACAGACTTCTTCCACGCGCACCACCCACCATTAACAATCTTCTTGAGGTCATCACTACCAGTGTAGTG
TGGATCAAGGATGAGAAAAGCACAATCACCGCTGGCTTCATTGTAATCAACTCCCAGAAGGGTATAAGCCAAAACTCCACCACCAATCATTACAGGAGTT
CCCTGGGTTTCAAAATGTATCGCAAGTTCTCTGCATTTCTCAGGAAGCTCATCACCAGATCTCACGTTAATTATCTTGCAACTAGCACCAAGAAGTTTGT
CAAGCACAAAGCTTAATTCTATCGCTCCAATCCATTCCCGAGATCCAATAAATGATGGATCCTTATCACCAATTTCAACAAGAACTTGCTGGATCTCCCT
GTGTGAAGGAACATTTATAGACGAATACTGTTGTAGCCTGTACCAAGACATGATTGTTTGTAGAGAACGGTAAGCACATCCCCATCCATTGTCATCGATA
CCATCATGTAGGTAATGGTAATACTCATATGAACCCTCAATCAATGACATGATTCCTCCAGATACACCACTAGATGGAATTTCTTTGTGGACATCTCGAA
GCAATGAGGAACCACTTTTAGATGAGCTTCTATCTCGCCTTTCCATGGCACCAAAAGTTAGTGCATTAGAAGTCCGTAATAAAGGACGATCCAAGGGCAG
ACCAAGCCTGAAGTGCAGATTTCTTCTCAGTTCACTCTGCTTTTCCTCAATCTCCCCGTATCTTGTGTCGTATATAGCTGTTAGAGGAATAAGCAACCCA
GGAGGAATAAAATGGTACGGACAAAGCTT
page-top