Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14788  (registered. 2012)
Contig Information
Length 1201 bp
Clones alternative view 74 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_r Root 1
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_RDr Root of dessiccated seed 5
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 8
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 2
WH_XB Root 7
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125577046|gb|EAZ18268.1|| hypothetical protein OsJ_33805 [Oryza sativa Japonica Group]
Score 548
Evalue 6.00E-154
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14788
TTTTTCAGTGTAACGTTGAGTTGATTGATCAGACTAAGTAGCACCAAAGTTTTCTGTCTCAAAAAAGAAAATAACACATACAGTATAATTTTCCCATATG
CAGAGCGTACACAGAAATAATATGGAAGATTATTGCAAATACTCAACATTCCATGACTCCAAGCGAACAATTCCTACAAAGAAATATGATGGAATGTGGT
TGGCAAACAAAACGAGGTGGGAGGTGTTTAGGGCTCCAGGGCGAGCAGACAAATCTCATACAAGCACAAGGCGGCATCACGCGGCGGCCAATAAGGCTTA
GAAGCGCGAGGCGTATGGACGATTAGCGGAGACAACCACACCATATGTATCATCATCCTACTCCTTGTACTTCATGCTCTCGAGCGAGAACCCGGGCATG
TCAAAGGAGAGGGCAAACTTCTCGACCTCGACCTTGAGGTTCTCGATGTCCTTGTTGTTCACCAGGCCCTTGGAGAAGTCCTTGAGCAGCTTCCCGTGCT
CCTTCTGGATGTTCAGGCAGATGGTCACAGCCTGGTGGAGGAACTCGGCGATCTGCTCGAAGTCCTTCTCGACCAAACCCCTGGAAGTCATCGCCGGAGC
GCCAATGCGGACACCACCAGGGGACAATGCACTGCTGTCACCGAAGACGGCATTCTTGTTCAATGTAATGCTGCAAAGGTCACACATCTTTTCGACCTTG
TTTCCAGTCAAGCCAAGAGGGCGGAGATCCCATAGAACAAGATGGTTGTCAGTTCCATCGGTCACCATCTTGTAACCCTTGCTCATGAGATATTTTCCAA
CGGCAACAGCGTTGGCCTTGACCTGCTTTGCGTAGGCCTTGAATCCAGGAGTCAAAGTTTGCTTCAGGGCAACTGCAAGGGCAGCAATCTGGTGGTTGTG
AGGACCACCCTGGAGCGATGGGAACACCGCAAAGTTGATCTTGTCCTCATAGTCATACACAGCACCCTCAGGCTGGCCCTTCTTCGCAGGCTTAGGGCCT
TTCCTGTAGAAGATCATGCCAGCCCTCGGTCCCCGGAGAGACTTGTGTGTTGTAGTGGTAACCACATCACAGAACTCAAAAGGATTTGCAGCTTCCTGCG
CGGCGACCAGTCCGCTGATGTGCGCCATGTCGCAGAGGAGCATGGCCCCGACCTTGTCGGCGACGGCCCTGAGCCTGGCGTAGTCCCAGTCCCTGGGGTA
G
page-top