Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14769  (registered. 2012)
Contig Information
Length 772 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115450223|ref|NP_001048712.1|| Os03g0109900 [Oryza sativa (japonica cultivar-group)]
Score 158
Evalue 5.00E-37
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14769
CGAGAATCGTACTAGGGTTTCGCCGCCGCCGCCTCCCCGCCATTGAAAATCGGCCCCTCGCCGCCTGTCCAGGCTCGTCCTTCCTTCCACGATTCGCACG
TTGCGTGCCCCGCCTCGTACGTCCACGGGCTGTACAAGATCCCGCCGTTGAACCGAAGTCCGCGGGACGAGTAGCCAAGGCACCAAGCTGACGCTGGCCA
GCCTCTTGTCCTGCCCAAAGGAAGGAAGGTCTGCTCCAGTCTTCAAAAAGATGCGGAAAGCTAAGAGGAGCGGTGATCATCTCACTAGAAGCTTTCTTAA
GAGCAGAAGAGCTTCCAAAAATGAATCATTGGTCTCAGGTTGCTTCATTGGGGACTCTGATCAAGGTGTTCGGTCTGGGCTCAGTGATAGGCTAATATCA
TACATGTCTAAAAGCGTCGTCTCTATTACTTTGTACAATGAAGGCACAATCCTATTTTCATGCTCGGGCATAGCTATGGAACGCAAGGGGTGCCACCTTA
CAAGGTTTCTGACTTCTGCAAGTTTGGTTAGAGCTCTGAATGGTACAAATGAAGACCATGATGACTTGAAGATTGAAGTGCGCCATGAAGGCAATGAAGT
GTATATGGGGGTGATGGCTGAATATGATTTAGATCGCAACTTTGCTGTTGTCAATGTCGATGCGTTCCTTGATGTTCANNTTCAATCTTTCCAACATGCA
CCGCGAATTCTCCCCCATGGTGAGAAATTAGTAGTTATGGGGCGTGACGTCAATGGTGAAATAATGACCAAG
page-top