Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14761  (registered. 2012)
Contig Information
Length 1764 bp
Clones alternative view 54 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 3
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_VABA Shoot with ABA treatment 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 11
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242041421|ref|XP_002468105.1|| hypothetical protein SORBIDRAFT_01g039660 [Sorghum bicolor]
Score 852
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14761
CTTCTACTAGACTTACGACAACAGAATATGGACTACATCAAATACACAATCACATCCTGAACTGTATCACAGCATGAAGAGAAAAAAGTGGAAAGTCATA
TAATACTACAAGGCACGAAAACCACCGGTATGGATCAGCACAAGGCCTGAAAGCGTTTTAGATGAGAAAATAAATATATGGGTGGCTTCAGACCCTTTCA
AATCATTGGGAAGGCGAGTCGCCATACTGCCACGGGTTGAACTCGATGGAGCTGACGTCCGTCTCCTCGGCAACGGCACTAGAGCTGTCTATCGCAGCCC
GGTGCTCGGCGTATCTGCCATTGTACTCATACACCTCCAGATCGCCCCACGGGGTAGGGGAGATGTCTTCGGTCATTTTGAACCATTTTGGTGTAAACTG
CTCCCCCTTGGTGTCCCGGATTTTCTTCTCAGCTCTTTGTTGTTCTTCAAGCCTGCTCTTGTGTGCCCCAGATTTAGACATGTCACCCTTCTCAAGGGCA
TATCTGTCGGGCCTTAATCGGGAGTCTGAAGGCAAGAGCTTCTTAGGTGCTGTATCAAAGCTATTTATTTTGTGCGCAAAGTATGTATACTGGTACTTGT
CATTCGGTGGAGCAGGAGCGGCTTTCCAGACCTCTTTTAGCTCGGTCCCTGGAAGAGGATCACCTTCTTGATCACAAGGCTGGTAACTCATGGACTTGTT
CCATTTTCCTGTCATCATTATTTTCGGTTCTTCAGCTGCAGTATATACATACCCATCCACCTCGAACCGCCCAGCCCCAAACCAGCCGCATGGCTGGAAA
TACAGCACGGCTTTGTCTCCAGTTGTCAAATTTGTCAGGACCATCTCTCCAAAAGAGTCTACCCATGTGCGCCCAAATATCAAGTTGTTGACCTTGGTCA
GTGGTGGTACCAATTCCAACACGACACCGGACTTTTTAAGTGTCACTCTAGTCCTTCCAACTGGATACACTTCCACTGAGTTTCCCAAGAACTTTGTCTT
CAACTTCGATGTGATGTCGTAAGTAAAATGATCGTTCTCACAGTGAGCTACACCCATCGGAGGATGATGGCTTACCTGCTCAGCAATAAATGTAATACCC
TGATGGTTAACCATCTCATACGTCTCTCCAAGGATGGGATTGAAAGGCTTCCACGTACGGTGGTAGGCTAGGTAGGCTGACAAAGCCCATGTAGAAGCAT
ATACCATCCGCATGTGCGGATCCTCACATTCATCTGCTTTGTCTAACAGGTCACAATATTCCATCAACTCCGCCATTTTCTGAAGCATTGACATCGGCTC
AAAGATGATGACTGGAAGTGTAACAAGTGACGTTACATCTGACCCTATGTACTTGTTCATCATCTTCCAGTAACTGTCCCGATCCTCCTGTTTCCATCGC
CCCTTCATAGCCTCTGCTTCCGCATCATCTGTGCCTCCATCTGGGTTGATAACTTCAAGCCCTTCATAGCCAACCAACCCGTTGACCGATTTGTGCACGG
CAGTGCCCCAGCTGCGCACGCCCGCGGCGATCGAGGAGAAGAAGCCTCCGCCACCGCCCGACGACGCGGCCAGGTCCTGGTCCTTGGACCCCATCGCCGG
CGATCTGCGCGGTCAGAGGGAAGCTCCCGCGCAGAGGAGTCGGGGAGGGGGATATGCTAGGGTTTGGGAAGCCGCACGAGGAGGGGGCGCCCGCTAACCC
CTGCCTAGAGATGGTGGTAGAGGAGCGCTGGTGAGGAGAGCGGCAGCGATGGCGATGGCGACGT
page-top