Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1475  (registered. 2012)
Contig Information
Length 723 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242045540|ref|XP_002460641.1|| hypothetical protein SORBIDRAFT_02g032270 [Sorghum bicolor]
Score 356
Evalue 1.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1475
GTGGCGAGCACGTCGTCGAATGATGAACCGNNNNNNNNCGCCAAGCATCCTGTTGACCGCAAAGAGTTGGGTCATACAAGTATAGGAGAAGGGGAGGTCA
AGTTACACAGGTGGAACTCAACCTGTGGTGTCAGGCGCGATTTGTGCGCCTTCCAACTTGAAGAGCCAGCTCGGTGTCTATCTTGAGAGATATGTCGAGC
GCCTTCACGGAATGCGTCAACGCTCCACTTGAAATGTATGTAACTCCAGTTTCTCCGATTTTCTTCACCGTATCGATCGTCACATTTCCAGATGCCTCTG
TCTCAAATCTTCCATTTATCAACTGAACTGCATCTTTGAGCATTGATACATCTAGATCCCCATTAGGAAGAGGTACAACCATATTATCCAACATTATACG
AGTTAATGAAGTCTTGTTCTCATCGGTATACTTCAATAAATCTCTAACTTCCTCGAGTGTCCTCGTCTCAACCTCAACAGGAATTGCAAGATTTTCCTTC
TCCAAGAACTGATCAACAGATGTCATTGCATTTGTAATGCCCCCAGCAACAGAAATATGATTATCTTTTATCATAACCATATCAAATAATCCAAGCCTGT
GATTCTTCCCACCACCAATTAGTACTGCCCACTTGTCAACCAGACGTAAACCTGGAGCAGTTTTTCTTGTTTCCAGTATGCATGCTGGACGAGCAGCATC
AGCCATGGCCTTCGTCATTGTAG
page-top