Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14734  (registered. 2012)
Contig Information
Length 808 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|293335169|ref|NP_001168479.1|| hypothetical protein LOC100382256 [Zea mays]
Score 234
Evalue 8.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14734
GTAGTAGTATTCCCGCCTTCCCGGCCAAAACAAAAACAGAAACAGCAGTAGCATAACAACAACATGTATAAGAAAAACTCAACACGCCGTCCCCTTTGGA
CTGTCATAGTTCTTCCAGAAAACCAAGAACACCAATGATCCGCCAACCAGGGTCGCGGTTAGCCGTCTGATTGACAGTAGCGGCCGTACGCAGTACTAGG
CATAATGGAGACAAGACGAAACAAATCTTCAAGGGTGGTAGAGCGCACAAGAAGACGCGACAGTGGTGCACAGGGGCCCTGGGCACACAGCGTACGTACA
TGATTCATGGGAGAATTAGCTAAGGTGACGATTTATGAAGGCGCTTCAATCGGGAGTTAATAGTGGTATTGCTTCTAGTAGTGGCCGTTGGCGGCGCCTG
AGTTGGTGGCGCTGCCGCTCTTGCCGTCGACGACGACCTCGGTCATGGGCACCTGGTCGGCCTTGCGCTTGCGGGCCTCCAGGATCTGCTGCGTCGACTT
GTAGTAGATGGCGTACAGGATGATCTGCCCCACAGCGAACATCACGCCCAGCCCGTTGGGGATGGTGATGTAGAGGTCGAACTTGATGAGGGCGTAGGCA
GTCCAGCAGATGCCATTGACGAGCGAGGCCACGGACAGGAACAGGGGCATGTACTCCACGCTCTTGGTCTGGATCACCATTTTCATGACGGAGAGCGGCG
CGGCGTACATGCCGGTGCCGAAGAGGACGCAGAGGATGCCGACGACCATGGACCTGCGGTCGTGGGTGTGGGCGAGGGAGAGGACGAGCGCGGCGACCCC
CGCGACGA
page-top