Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14710  (registered. 2012)
Contig Information
Length 728 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_CSEC Callus 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XE Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|197131748|gb|ACH47392.1|| ribosomal protein L23 [Erodium chrysanthum]
Score 282
Evalue 2.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14710
GGCACGAGGCGAATTCTTATCGATACTGGAACTNNNNNNNNAGGAGGGAAAGTCGATTTATGGATGGAATCAAATACGCAGTATTTACAGAAAAAAGTCT
TCGTTTATTGGGAAAGAATCAATATACTTTTAATGTCGAATCGGGATTCACTAAGACAGAAATAAAGCATTGGGTCGAACTCTTCTTTGGTGTTAAGGTG
GTAGCTGTGAATAGCCATCGACTACCTGGAAAAGGTAGAAGAATAGGACCTATTCTGGGCCATACAATGCATTACAGACGTATGATCATTACCCTTCAAC
CGGGTTATTCTATTCCACTTCTAGATAGAGAAAAAAACTAAAGGAGAATACTTAATAATATGGCGAAACATTTATACAAAACACCTATCCCGAGCACACG
CAAGGGAACCGTAGACAGGCAAGTGAAATCCAATCCACGAAATAATTTGATCCATGGACGGCACCGTTGTGGTAAAGGTCGTAATTCCAGAGGAATCATT
ACCGCAAGGCATAGAGGGGGAGGTCATAAGCGCCTATACCGTAAAATAGATTTTCGACGGAATCAAAAAGACATATCTGGTAGAATCGTAACCATAGAAT
ACGACCCTAATCGAAATGCATACATTTGTCTCATACACTATGGGGATGGTGAGAAGAGATATATTTTACATCCCNNNNNGGCTATAATTGGAGATACTAT
TGTTTCTGGTACAAAAGTTCCTATATCA
page-top