Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14692  (registered. 2012)
Contig Information
Length 441 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242071731|ref|XP_002451142.1|| hypothetical protein SORBIDRAFT_05g024930 [Sorghum bicolor]
Score 181
Evalue 3.00E-44
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14692
TCTCCTCGGGGCAGTACTTGTGTTGCTTGTAGCTGCAGTTGTCCAACTCCTTTACAAAAACTTCTACAGGCTCTACTACTCAGCCTATAAGCTGCCTCCT
GGTAATCTCGGCGTGCCGGTTATCGGCAGTACTTTCTCTCTCCTCCGCGCCTGCCGCAGCAACACCGACGACCAATGGTTCCGAGACCGGATCAAGAATT
ACGGCCCGGTCTCTACCATGTCGCTGTTTGGATCGCCGACGGTGCTACTGGCCGGGCCGGCGGCGAACCATTTCATATTCGGCAACGACGGCCTAATCTT
GACGCAGACAGGCGCGCTGAGAGCCCTCGTTGGGCGGTCGGTACTGGCACTCACGGGCAGCGAGCTGAAGCTGGTCCGCAGCGCCCTGCANNNTTACTTG
AAGCCAGAGATGGTGAGGAGATACGTCTGCAAGATAGACCA
page-top