Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14654  (registered. 2012)
Contig Information
Length 1198 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_SHDr Shoot grown with dessication 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 7
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 12
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57233444|gb|AAW48295.1|| pore-forming toxin-like protein Hfr-2 [Triticum aestivum]
Score 792
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14654
AAAGGATGTTTCCAGTGACGGGCTCGCCGAAATGCGTTGCTTTCCGATCAAAGCATACCCGCAAGTACCTAGGTAGCGTGCAAGCAGGGAGCGAGGAGAG
CGCCGGCGGAGGCAAGTTCTTCGAGGAGCTGAGCCACGGCGCCGACGACGTCGATGTCCTTGCAAGCCCGTACACTAGATTCTACCTGGAGCCATCCAAG
GAGCACGACGGGCTCCTGCACGTCAGGTGCTGCCACAACAACAAGTACTGGGTGGCCAAACATGTCGGTGAAGGCAGCGGCCACTGGATCATTGGCATCG
TCAATGAACCGGAGGACGACCTGTCCAAGCCGTCATGCACGCTTTTTGAGCCCATCCCTCTCGCGGACACGGACAATAATCTATCCATCAGGTTCTTCCG
TCCTCAGCAGACAACAAGCTCTGAATCTGATATGACCAAGGAAAAGGGGACAACTGAAGAAGCCTACCTGTTTCTGGGAATCGGAGGGCATGAAAAAACA
GTTGATCAAGTTAAATCTCTTCATGACTTCTCCGCCATTGATCTGTCGAAGCAATTGGTACTACCTAAATATGTTGCTTTTAAAGGCGACAATGACATGT
ACCTCCGGGCAAGGATCATCCAGAAACGCAATTACCTGGAATTCTCATCATCTGATATTGCAGATTCAACTGTGGTCAACACTATTTTCCCCAACTATGC
TAATGGAAACGTGCGCATAAAATCTAACCACTTCAACAGGTTTTGGAGGCTCAGCCCCAACTGGATCTGGGCTGACTCCGCCGACAGCAGCAGCAGAGAC
CGTGACACACTCTTCAGGGTGGTCATGTTGCCTGACTACATCGGTCTCCAGAACCTGGGAAACTCCAGGTACTGCAAGAGGCTAACTGCCGACAGAAAGA
CAAGCTGCCTTAACGCCGCCGTCGATACCATCACACTGGAAGCAAGGTTACGGGTGGAAGAAGCCGTACTTTCCCGAAAGATCTATGGCGTGGAGTTCAA
GCTCTCCGAAGCTAGGATCTACGGCGAGAAGCCTATTACCTTTCCCAGCATGACTTCAACCAATGACACCAACGAACCACATGCCAAGACCCTGACCCTG
AAATACGAGGAGACGCAGGCCAAGACCTGGAGCTCGACTGTTAGCCTCAAGATTGGTGTCACGGCCAAGTTAAGAGCTGGGATCCCAGTCATAGCAGA
page-top