Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1463  (registered. 2012)
Contig Information
Length 971 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 5
Wh_yd Spikelet at late flowering 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 2
Wh_VHS Shoot with heat shock treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XB Root 3
WH_XD Root, treated at 50 microM Al for 6h 6
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68655500|emb|CAJ01714.1|| methionine synthase 2 enzyme [Hordeum vulgare subsp. vulgare]
Score 500
Evalue 1.00E-139
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1463
TTATAACGAACCGCGACGAGACATAAGCTCAAGACCGCAGCCTGTAAACAATAAGAAACCACCCACCAAACATAGATACAACATGTCAACACGCACCAGT
TTACCATAGCAGGACTAACCCTAGCCAAACTCCGGACGGCGGTACGATAAAGAATCGGATTATTCGAAACAAATGTGGCTCATTTGGCGCTCTGTCCCCA
CAAAACAATAGGTAGTAGTATCAGGCTCTTCACTTTGTGCTGGCGAGCTGGGTGCGGATGAGCTTGGCCGCGGCGACCATGTTGGTCAGGGCGGGCTTCA
CCTCCGTGTACTTGCGGGTCTTGAGGCCGCAGTCAGGGTTCACCCACAGGATGTTGGTGTCGAGCACCGCGAGCATCTTGTTGACGCGGTCGGCAATCTC
CTCCGTGGAGGGGATCCTGGGGGAGTGGATGTCGTAGACGCCAGGGCCAATGCCGGCTCCGTAGGTCACGCCCTCGCGGAAGACCGAGAGGAGCTTCTCG
TCGGAGCGGGAGTTCTCAATGGTGATGACGTCGGCGTCCATGTTGATGATGGAGTGGATGATATCGTTGAAGTTGGAGTAGCACATGTGAGTGTGAATCT
GAGTGGTATCTTGCACACCGCAGTTGGTGATTCTGAATGAGTGGACAGCCCAGTCCAAGTAGAAAGCATGCTCCGACTTGCGCAGCGGCAGACCCTCTCT
TAGAGCAGCCTCATCGATCTGGATCACCTGAATACCACCAGCCTCGAGATCCTCAACCTCCTTTTTAATGGCAAGAGCAATCTGGTAGCATGTCTCAAAC
CTTGGCTGGTCGTTCCTGACAAAAGACCAGTTGAGGATTGTGACAGGGCCAGTCAACATTCCCTTCATTGGGCGAGGGGTCATGTCCTGAGCCATCTTGG
ACCAGAAGACTGTCATGGGGTTGGGGCGGCTGACATCACCATAGATGATCGGTGGCTTCACGCAACGTGAT
page-top