Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14605  (registered. 2012)
Contig Information
Length 1092 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 1
Wh_VHS Shoot with heat shock treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115477340|ref|NP_001062266.1|| Os08g0520300 [Oryza sativa (japonica cultivar-group)]
Score 476
Evalue 2.00E-132
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14605
GGAGAGCATTACATTAATCAACCGCAGATTCACATTAAAATACATCCGGTACTCTGTTAAGGAGGGCTACCCAACGAAATCAGACCAGTAAATTGGTCAA
TAGTACAGCAATGAGAAGAAAAATAAAAACACAATCCCGCGACAAGCACATGAAAAGCTCTCACGACAATAGTACATGAAAATAGAAAAATACGAGAACC
GGAGAGGAAGGTCAGGTCAGGCTTGCATCAAACAAGCTGAGCGCTACAAATGCCTTTCCTCCTTTAACCCTATATACTAGTTGTAGTACATGAGCTGCTG
CGCCGACGTCTGGCTCGGGTAGCCGTCGTACAGGGCCTGGGAGCCAGCAGCGAGTAGCCCCGCGGATACCTGGCCCGCGAGGCCGTGCTGGCCAGCAATC
TGCCCTGCCGCCGCCTGGCTCAAGGCAAGCTGCCTCTGATAGGCTAGAAGTTCGGCTGCTGTGAAGCCTTGCGGCACGCCAGCCATTGCTATGGGTTGAT
ATGAGGCAATCGGGGGCGGCAGCGGCTTAGAAGATGTCCCAGGGGGTGTTGGTTTGTTGCCCCATGAGCACTTGATTGGCTTGCCGCGAACGACCAATCC
GTTGGCCATCTGAATAGCTAATGCTGCTTCACCATGGGTACTGTACCTTATAAATCCAAACCCTTTTTCCTGTTGAACACGAACTTCCTCAATAGCTCCG
ACCCCTAAGTTGTAGAAATGGCGGTGAAGCTCATCCCGATTAACCTCGTGTCCAAGGTTGCCAACGTACACCGTTGTGAAATCAGGGTTGTTCTCTGGAT
TTTCTTTGCTTCCTGTATCCTGGTTTGCCTCCATTGCTGCATTACTGGAACCACCATTTGTTAGTACAACTGCATTATGATTGTCCGTTTCTTGTTTCTC
TTCTGCGTTGGTCTTTGTTGCCCAGTTGCACCTTATTTGTCTACTGCCAAGCCATTTACCAGTCATTTCAGTTATAGCAGTTTCAGCTTCCTGCTGATTA
CGGAAGGAGACAAAGCCATAACCTCTGAAGTGAATGATGCAACTCTTTATGCCTGTTTCTCAACATATCCTTCTTGCTCTGATGCTCGAGTC
page-top