Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14598  (registered. 2012)
Contig Information
Length 743 bp
Clones alternative view 134 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 10
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 3
Wh_r Root 2
Wh_yd Spikelet at late flowering 6
Wh_CSEC Callus 12
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 11
Wh_PCDAM Anther at meiosis 5
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 7
Wh_VSCB Liquid cultured tissue 6
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 6
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 4
WH_XA Root 9
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242092324|ref|XP_002436652.1|| hypothetical protein SORBIDRAFT_10g006620 [Sorghum bicolor]
Score 235
Evalue 3.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14598
ATAAATCAATCTTTTATTGAGCAACGAGCATAAACTTCAAAGATCAACAGTAATATATCGAATCACTTCAGATAAACGGTGAGATAAACAGATCATGTCC
ACCATACGCAGATCAAAACACCTCGAACTTAAGCCTTGAGTTCAAAACATTACTTGCCACAAGTAACAGATCTAAAAGACATAAAGCATAATATAGGGGT
ACGATGACGATGCGGAGGAACCTAGGCGCGGTTGCCACCGCGGGGTCCGTTGAAGGGCTGGCGGTAGGGGGCGGCGGCAGAGGTGGTTTCGGGGGCGCGC
TCGACGCCGGGGAGGTCAGCCATGCCGAGGAACGCCAGCATGTCCATGGTCTCCTTGTCGACGCGGATCTCGTCGACCTCGAGCGCCGACTTCTCCGGCA
CGAAGTCCATGCGGCGCTCACGCTCCTCCTCCTGCAGCTTGAGGGAGATGCCGCGCACGGGGCCGCGCTGGATGCGGCGCATCAGATGGGTGGTGAAGCC
GGCCACCTTGTTGCGGAGGCGCTTCGACTGGAGGATGGAGACCTCCTCTAGCACCTTCTTGTTGGTGTGGAAGTCGAGGGTCATCCGAGAGTAGTACTTC
TCGATGACCTGGCGGGAGGTCTTCTTCACGGTCTTGGTGCGGACGCGACCCATGGCTGCGGCTGCTCCCTCTCCTTCTCCGGCGGCGGCGGCGGCGACGG
CGCTGGTTGGTGGTGCGGCGGCGCGAGGGCTCGTGCCTCGTGC
page-top