Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14586  (registered. 2012)
Contig Information
Length 876 bp
Clones alternative view 94 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 9
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 7
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 9
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 10
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 13
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_SP 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 14
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224551500|gb|ACN54192.1|| blue copper protein [Triticum aestivum]
Score 332
Evalue 3.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14586
GCATTCAGCAGCACCAGCCTTCTACCTCCTCTGCTTTGCATTCCGCCTTCCAGTTCCAATTCCAACCGCAATCAATGGCTGCCATGAAGATCGCCCTCCT
TGCCGTGGCCGCGATGGCCGTCTTGCTAGGCACCGCGTCAGCGGTAACCTACAACGTCGGCGATCAGGGCGGTTGGACCCTCAGCACCGACTACAGCAGC
TGGGTGTCCGGCAAGAAGTTCAACGTGGGTGATGAGATCGTCTTCAAGTACTCGACCCCAACGCACGACGTGGTCGAGGTCAGCAAGGCCGGCTACGACT
CCTGCAGCATCGACGGCGCCATCAACACCTTGGCCTCCGGCAACGACGTCATCACCCTCAACGCCACCGGCACCCGGTACTTCATCTGTGGCGTCCCTAA
CCATTGCAGCCCCACCGCCGCCGCCAGCATGAAGGTCGTGATCAACGTCGCCTCGGGCTCCTCCTCGCCGTCGTCACCCATGCCAGCTGCAGGTCCTGGC
GCGAGCAACTCTCCCCCGGCGCCGCCCTCCAACGCCGCTACCTCCGTCGGTGCCACAGCAGGATTTGGCCTCGTCGCCCTACTGGCGGCCGGTCTCATGG
CTTGAACGCATATATTGATCAGCTGCCGCGCGCACATACGAGCTTTTATATTGTTAACTACTATACTGTAGTTATTATCACGGGTGAATACATGTATTCT
TTTTTAGAGCGAGAATGTGATAGTTACTTGTATCTATCACGTCTATATGTAATCTGCAGGCCTTCATGTCTTTTTATATAATGATTCTAGACTATTATTT
TAAAAAAAAAAGTCAGTGCATGCGCAGCAGTACCAATAGTCTTCTAACTAAAAAGAAAGAATCAATAGTCCTCTCA
page-top