Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14565  (registered. 2012)
Contig Information
Length 837 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242091627|ref|XP_002441646.1|| hypothetical protein SORBIDRAFT_09g030890 [Sorghum bicolor]
Score 182
Evalue 5.00E-44
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14565
AAAAGGTAGTAAATGTCTATCTTGTCTCTGAACTCAAATACACAGACAGGCATATATATGTATGTAGTCAGAAGAGCCAATTCATTGTTGTACTTGTAGG
GTGAAAAACAAAATAAATAAAAGTCGAGTTAGTGATCTGAGTCTGAATCTGAGATGGTATTGCTTGATCCATGTAGTAGGATATGTGCTTAGCTGGAAAG
AAACAAACAGACAGACGGGCCCATTCATCAATGTTGAGGAGTTGTTCAGCCACCCCTGGAATTGGAATTGGAGTTGGAGTTGAAATTGGGTCTCTTGAGC
TTGACAACGAATTCTTTGTCGTCGTGGTCATCGTCGCTGCTGTACTCAACTCTTCTCTTGGCCTTGGCGGCGGAATGATCTGTGTTGTGACGCGCTGTGG
AAGAAGAAGAAACCAGTGGTACCGGTTTCTTCCAGCTCTCTGCAGGTTTGTGTTTGGTGACAGTGGTGGAATTTGGCGACTTGATGGGGGTCCCTGATTT
GATCTGCTGCTGCCGTTTGAGCTTTCTGTCATAGGCTTTCTTGGCTCTCTCCGGAGATAACAGCCCATGCTCCATTAACCAGAATTCGGCCATGTCGCTG
GATGGGATCTGCTTGGAGAGCGATTCGTAGAAGATCCTCAGGGGCTCCCTCTCCTCTGGGGTGTCGAACTTCTGGCCGGTGAGGGAGAAGACCTTCTTGG
CCTTGGCCTTGGCCTTGCCCCGGCCGCTAGCTGTAGTAGCGGCTTTCTTGGCGGCGGCGGTGGCGGCTGCGAGCTTGGCCCTGGAGGCGGCCAGCGATAT
GGATCTCCCGGATCCGCCTGCTCCTCCTCCTCCTTTA
page-top