Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14555  (registered. 2012)
Contig Information
Length 413 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig14555
GGGACACAGGTACGACATCGACATGAGGCAAAGAAATTAAACTCCATATACATGGACTAAAAGGGCATGAAAGACGTACACAGACAAACACTAGTAAAGC
AGAACGACAGCCACATCTCCACCAAAGCAACAACGCACTGATTGAAGATGATTAAAAAGAATGCACTACGTTTCTCGCTGCTTCATGATCAACACCGCAC
CTAGAAAGCGAGGACGGAGGCCACGGCGACGCCGACGAGGCCGCGGACGCCAGCAAAAGCGGCCGCAGCGGCGGCAAAACCGCTGCTCTCCGGGCCTATG
ATGCTCGCCGTAGGGCCGGACGCGCTGCCGATCGGCGTGGTGAAGCTCCCTCCCATGCCGGGCGTAGCTGGGTTCGTCGAGCCCGGGGAAGAAGAGTTGG
TGCCGGTGCCCGT
page-top