Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14554  (registered. 2012)
Contig Information
Length 1297 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 1
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14571547|gb|AAK64576.1|| serine/threonine protein kinase [Triticum aestivum]
Score 655
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14554
GCTTTGCATATGCCCTGCATGGTGATGATGATTATATAACACATGAACAGAGCAGCAGGAGCATGGCGTCGGTACAACCAGAGGAAACCGCATGACAATG
TTCTGACAATGTTAAGGATAAACCTGTCTCCAGTACAATGACAGTTTTAAGACGACGACAGGGACTATGGTATGGTCTAAGATAAATATGTGAAGCCCGA
GCACACACGTATGCTCAGGTGGGCTTTTCCGCTTCTGTACCAAAAGTATTAATATGATAAATACATGGGATTTAACTTCTCTCCAGATTGCTTTCTCTTC
TCCTGGATTCTGCCTGCTTTAGTCTAAGGTCATGGGTTGGGAGATGCAACATCGGAATCTGGCCTTGCGGACATTTTTCAGGACCTCCATCTCCACACGC
TCCAGCATTCTCACAACATCGGTAAAAGGGGGGCGGACATCGGGGTTTGCATCCCAGCACCTTGTCATGATCTCCCCAAGGGCAGGTAGGCAGTCATGGG
GTATGGCTGGGCGGACACCCTTGTTCACCACAGCAAATGCAGCTTGCACTGCTGTCATGTTTGGAAAAGGAAGGGTCCCGGTTATTAGCTCCCACAGGAC
AATGCCAAAACTGTAGACATCAACTTTCTGATTGTATGGTCTGTGCTGGATCATCTCAGGAGCCATCCAACGGTATGTTCCTGTTTCAGGTGTCATCCCC
TCGGTCTTCACTTCAATCCTAGCAACTCCGAAGTCAGCGATCTTGATCGATTTATCACCAGAAATCAAGAGGTTATCTGACTTAAGATCTCTGTGGATGA
ACCCAAGGCCATGAACATAAGCCATGCCACGTGCAACATCTAGTGCCTGCTTCACTGCCAGCTTCAGTGGAACAGACCTGTTCTGCCTCCTATTCAGGAA
ATTCCTAACAGATCCACCCTTTGCATACCCTGTGACAATGCACCAAACTATTGGCTTCCTGCATGCGCCAACGAACTTGACTATATTTGGATGCCTTAAT
TCTGCAAGCATCATAACTTCTTGCACAAACTGTTGCTCCAGCAGCTGAGCTTGTGCGGGGTCAGCCTCGGGCCTCTCCAAAAGCTTAATGGCAACATCCA
TCCCATTGTAGGTCCCCCTGTATAGCTTCCCAAATGCGCCTTGTGCAAAGGGCAATCCCATGTGGAGCTTCCCCAAATCAATGGTCCACTCCTCATAATC
CTTGAGTGTCTCAGTCGGGAATCTAGTGTCCATCAAAGCCTGTGCCAACGCATCATCACTCAAGGCATGAGACACCCGCCCAGGACGGAAAATGCTG
page-top