Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14512  (registered. 2012)
Contig Information
Length 2106 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473019|ref|NP_001060108.1|| Os07g0582400 [Oryza sativa (japonica cultivar-group)]
Score 832
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14512
CACATACTGATAGTTTTTTCTTACACATTTTCCGTGGCTCGCCTGACTCACTCGATCGGCAGGTAGATTCCTCGAACCACCGCCAGTTTTTCTCTCCTAA
CCAAAGCTCGCGTGCACTTGACCCATGCAGCGCGAGTACGAGACAAACGCCACGGAAGTAGCTAGGGCACACCTCTACAGTCTACTACAGTAGTCTAGTC
CGGCGGCGATTAGCCTTGGCATTGGCACTGTCGGATTGCTCACAGCCTGCTACCCGGACAAAACGAGCCAAATCACGAAAAATTAAACTTATAGCACATT
TAAGAAGCCATTAACGTCTCGATCGAGCTGGAGCTTGCCGTCGCTCTCCGGCAGCACCGGCCGGATCAGCGAATCTTCCCACGCTACTTCGTCATCTATG
TGGCAGTGTGGCAGCTAGCTAGCCGAGACGGACGGATACAGCGCAAGTCTTCGCATCGCGATCTGCCAACTTGCGTTCAGTTGGTGGCGGCCATTTCCAC
CTTCTTCTCCTTCCCGGCGTCGTCGTCGGCATCCGCGGCGCCCTGCTTGTGCGTGGCCGTGTGGCCGAACAGCGAGCTCATGTCCTCCAGCGTGCGGCCG
CGGGTCTCCGGCAGGTAGGCGAAGAAGAACACCCAGGCGAACGAGGCGATGCCGGCGAAGAGGAAGAAGGCGCCGCCGATGGTCATGGCCTTGGACAGCG
AAATGAAGGTCATGGAGATCACGCCGCTGGTCAGGCGGTTGACGGCCACGCCGAGGGAGCAGCCCAGCGCGCGCACGTGCAGCGGGAAGATCTCCGAGCT
GTACACCCAAGTGATGGGGCCGAGGCCGATGGAGAAGAAGGCCACGTAGGCCATGATGCAGAAGATGCACAGGACGATGGCCCAGGTGATCTTCTCGTCC
GGGTGGCGGCTGATGACGGTGAGCCCCGTCGCGAGGCCCACTAGGGAGACGATCACGCCGCCCGTGCTGCTCAGCAGAAGCGGCCGCCGGCCGATGCGGT
CGAGGAGGAAGGTGGCCACCAGGATGAAGACTGTCTTGGTGGCCCCGACGGCCACGGTGGTGCCGAGGAGGCGGTTGTCGCCCGTGATGCCGGCGCTCTT
GAAAACTCGCGGGCTGTAGAGCACGACGGCGTCGATGCCCGAAGACTGCTGGAAGAAGTGGATGCCGATTCCCGCGATGAGGATGTGGCGCATGGCTTTG
GTCGGGGAAAGGATGAGGTCCTTCCACACGCGCTTCTCCTCGCTGCTTCCTTTGTTTTTGGGCACGGCGACCACGTCGCCGTCGAGGTCCAGAGGGATGC
CGGCGGCAGTCTTGATGTCGGCGAGGCGCTCAGCGGCCTCCTCGGGCGTGTCGGAAGTCTTGGCAAGAACAACCTTGGCGTCCGCGAGACGGCCCTTCAT
GACGAGCCACCGGGGAGACTCGGGCATGCCGAGCACCATGAACGCGAGCAGGACGGACGGCACCGCGCCTATGCCGAGCATGATGCGCCAGCCGAGGCGG
AGGGAGAGGCGGGCGAAGGCGAAGTTGGAGACATATCCGAGGAGGATGCCGAAGTTGATGAACACCTCCGGGAAGGAGGTGAGAAAGCCACGGGCAGACG
CGGGGGACACCTCGGCCGTGTACACGGGCGCGATCATGAGAGCGTACCCCACGCCGATGCCGGCCACGAAGCGGCCGAACATGAGCATGGCGTAGTTGAC
GGAGAAGCCCATGATGAGGGCGCCCGCGAAGAAGATGACGGCGGCGAAGACGATGGTGAAGCGCCGGCCGATCCAGTCGGACGTCCGCCCCGCCGCGAAG
GAGCCAATGAGCGAGTACACGTTGAGGATGCCCATGAGGACCTCCAGCTGGGTGTCGTTGATCTTCAGATCCTTCTGGATGTACAGCGACGCTCCGCTCA
TCACGCCGATGTCGTAGCCGAGGAGGATGGAGGTCATGGAGGCGAGGATGGCGCAGGCGAAGGCGAACCTCACGTTGCCCTTCTTCTTGGGCTCGACGGC
CGCCGGGAGTGCGGCGCGGTCCATCGTCGACGACGCCCCTCTGCTCGCTGCCTGAGGATTATGCCGACGAGGTCCTCCTTGTGTATAGTTTAGTGGTGCT
CGAGAG
page-top