Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14447  (registered. 2012)
Contig Information
Length 1256 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 7
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|238014202|gb|ACR38136.1|| unknown [Zea mays]
Score 466
Evalue 3.00E-129
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14447
GGATTTGGACTAGCTGCCTGTTCCATCTAATAAACAGCATCGCAGGCTGACGAACGGCACACACACTACTTGTCTACACATCCGAAGCATCTTGCCTGTG
GACGGGCATTGTGCTTCCCAGATTCATTCATAACAAACAATGTGGGGGGTGACCATGAAATGAAACAGTGTTCTCATGGCAACACAGATCTTCAGCAGGC
GGGTGATGGGCAGACTTGGGGTCCAAGGTCCTGCCATGCTGCTGTGTCGTCGTGTGAACTCGCAAACCATGTGTTATCCACCTCACAAGGCCTGTAGGCC
CAAATCCAATGAAGCCGCCGCATGCTGTGCCTTGGTATGTACAGGTGGGCTAGGTGACTCCTCTTCGGTGTTCATGAGGCGCCTGCTGCAACTTCTGGTG
CCTTTTCTTGCGCCTCGTCCTTGCTCAGCAATGCTGGTGTGACCGAGACCACCCCAATCAAGAACAGCAGAGCTACTGACTGGGTATCGTACAGGTCGCT
GAGCGATGTTAGCTCTCCCAGAGCAATCCCAGCCCTCACAGTCACGTAGGCTGCTGGGATGAGACCGATAAGAGTTGCCAATAAGAAGGTATGGAAGGGC
ACATCAACAATGGGCGATGCCAAGTTGATGAAGGTATTTGGCAATGTTGGGGTGACCCTGAGGAAAAGCATGTAATTCAACAGCTTTTCTCTTCTTTTGG
CTACCTGCTTCTGGAAAAATGTGAGCTTGTCTGGCCACAGCACGAACACCAGTGGTTTTCCAATCAGCTTCGACAGGAAAAAGCATGAAGAAGCACCAGC
TGAGGCAGCAAAGACAACCAGAGCCACACCCCGGAGTTGCCCGAATAGAGCACCAGCAAGCAATGACATGAATATTGTCCCTGGGATCATGAAGGTCTGC
ATGAAAATGTACACAGCACAGTAACCTATCAACACCTGTACGGTGTAGTCACTGGTATAGTTCTCAAGATGGCCAGTGAGGATTTGGAGTTCGTGGAGGT
TGCGGGGCAGCTTGAGGAAGCTGTAGTCGGAGTCCGGCATGGAGAGGTAGACCCCGACGAGGCCCGCGGCGAAGACGGCGGCGACCCCGGCGCCGAGCGC
GGCCTCCCAGACCGGGAACCTGTCCTCCCTCCCCATCCCCTCCTCCTCCTCCTCCTCCTGCGGGGGAATCCGGCCGGGGTCCGGGCGAGGAGAGGGGCAG
AAGAAATAAGGTGAAATTTGGGGAGGGGGGGAGAGCTTTCTCCTCGTGCCGAATTC
page-top