Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14426  (registered. 2012)
Contig Information
Length 1194 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_SHDr Shoot grown with dessication 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|189172063|gb|ACD80387.1|| WRKY40 transcription factor [Triticum aestivum]
Score 322
Evalue 4.00E-86
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14426
AGAAATAACATGAGAGTTTGCAGAAATGAACTCTGCCTTCTGAATTAGCAGTGGTATTTCATTTCAATTGAACTAAGAAAATCTTGGCCACATCTCACAT
GCAAGTATCTGGTGCTCTAGCATGCGTGTAGATGGAAAAAACATGTGTATCATATTAGTTCTTTGAGGTAAGATCAATTGTCTTCCACTGATCCATTTAC
AAAAAATGGAAGAATCTGATAGAACCGAATCTCCCTGCATCTATGTCTTCTGAAATGTATGCATCTTGGCACTCGGTGCTGCAGGACTGGAGATCAGCAC
AGGCCGTCTTTTGCTCCACAACGCCGGGGGCCCAGGAAGAAAGCGCCTCTGAACGCAGCGCAAGGGGCTTGTTCTTGCACTCTGAAGGCGTGCCGCGTGG
CGCCGCACTCGAAGATGGCGAGCTGGCATTGGCTCCGGGCTCCTGAGCCCCGGATGAATCAAAGCAGATGGAGACTGCCTTTCCAGATGCGGTCTGCAGC
TGGAACTCTGTGGGGGTGAGGGCAAGGAAGGCGCTGTTGCATGAATGCTCGTTGTAGTATGTGACTTGGTACAATGGGGGGTCGCTGTGATCCTTCTGCT
GAATCTGTTTGGTGGCCGGGCAGTTCATGTTGTCTTTGTAGGTGCATCTGTAGTAGTACCTGTGGCAGGATAGAAAGAAGAAGACGAATCTTCTGTGAGT
AAATCGGAGGACTGAGGCTTCTCTTCATATATTGGTAAGTTTGTTACACTGTGCATCCCTATGGTAGATTTGGATGAGAAGAATGAAAAGACCACCAAGG
AATCATCAGAGAGAGGTCGGTAAAAAGACTTGTGATGTGCCAAGACGAGGCGCTAGATACTAATGGTTTTTTGGGAGCATATGCAGATGCAGATCACCAA
ATGAGGACGAAGATGAGGAGACCAAAGGCGGGCTGCTAACCTGGGAAAGTTGCAGTTGTTGATCTTCTTCTCGCCGTACTTCCTCCATTGGTGGCCGTCG
TTGTGCGGCGCAAAGGTATCCACCTTCCTCATGCGCTTCTCTTTCCTTGATCCATGGCCTAGAAGGTGTGATTGATTTGGGCTCGGCACGGGAGACATTG
TTGCCCAGTCCCAGAGCAAGAAAGGAAGCGCAGAGGAGAGGAGAGGAAGACGAAGGAGGAGGAGGAAGAAGAAAGGAAAAGAAAGGTATGAGGA
page-top