Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14283  (registered. 2012)
Contig Information
Length 541 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|227133339|gb|ACP19711.1|| PDR-type ABC transporter [Triticum aestivum]
Score 338
Evalue 2.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14283
GGCATCTCCTATGATGTACAGCCAGAATGCGATATCCGTCAATGAATTCCTTTCAAGTAGGTGGGCCAACCCAAACAATGACACATCTATTGATGCACGA
ACAGTAGGCGAGGCTATTCTTAAAGCCAAAGGCTATTTTACTAGAGATTCGGGATTTTGGGTTTCCATTGGAGCCATTGTAGGATTCACTATTTTATTCA
ACATATTGTACCTTCTGGCACTTACGTACTTGAGCTTTGGCAGCAGCTCAAACACAGTTTCAGACGAGGAGAATGAGAATGAAACAAACACTTCAATACC
CATAGATGAAGCCACAAATCGGCCAACTCGGTCACAAATCACCTTGCCTTTCCAGCCTCTTTCACTTTCTTTCAACCATGTAAACTACTACGTGGACATG
CCTGCAGAAATGAGAGAGCAAGGATTCACAGAAAGTCGTCTCCAGTTGCTCTCTGATATCAGTGGTGCTTTTAGACCTGGTGTTCTGACAGCATTAGTTG
GTGTGAGTGGAGCTGGGAAAACCACTCTAATGGATGTCCTG
page-top