Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1428  (registered. 2012)
Contig Information
Length 832 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218188934|gb|EEC71361.1|| hypothetical protein OsI_03454 [Oryza sativa Indica Group]
Score 227
Evalue 1.00E-57
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1428
ACATACAGGAAAAGGCGGCAGGACGAGATACACATTATTCCCTGATTTCAACACAGGACAGTATCCAAAATGCACCAACTTAAAATCATTCCTAGGCAAT
GAAAGGAATGCCCTCTCAGGTACAACCAACGAATTGATTCGAGTTATGCTACAACACAGAGACAACACGCGGGCAAGAAGACAACAGGCTGGGCCTACGC
TTCCATCCATCCATGTACAAGAGAGCAGATGTCGGCGCGCAGCTGACGGGGTCGACAACACCATCAAAACTCCCTGTGCGCCACTTGCAGTATTGTGAGC
GCCTCTCCTCTTGAACATCGCTCGTAGAGCTCTGAGGCGAGCTCGAGGAGAGACTCGGTCTCCTCAGCCATCTTGCCGATCCTTTCAACCTCCATCATGT
GCTCGTTTGCGAGGTGCGATTTGGCCTCCGCGTCGGCTACTTTCATCGCTGCAGCTTCAGCTGCGTCCAGTGCAGGACTCAACTGGCCTAGACCCTTTGC
TGCCTTGGATGACTTGGCTGAATCCTTCTTCTTTAGAGATGGATCTTTCATTGGAGCCAGAGCCCTTTTTGCATATGAATCCGTCAGCTTATAGGACTTA
TCAATCTTCTCAACTTTGTTCACGCCTATAAGCCTTCGTAATTTGGCACAAAGCAACCTTCTAAAATTTGGTTGCACCTCATGCCTTTGCTCTATGAAAT
TGCAAATTGTAGCAACTTCTGAACCATTTGGCTCTTTCAGTTCGTCGAGAGCTTCCAGGATCATGGAACTGTACAACTTTGGACTCGGAGTCTTGTCATC
CTGTGGGCTTTTTTCACAATCTTCTGGTGGAG
page-top