Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14257  (registered. 2012)
Contig Information
Length 1304 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_SH - 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XV Leaves, plant was grown at constant 23 6
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115479005|ref|NP_001063096.1|| Os09g0394900 [Oryza sativa (japonica cultivar-group)]
Score 578
Evalue 4.00E-163
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14257
ACAGTGTGAACTTCAGTGAAAGCAGTAAAGCCAAATACAATCATCAAACCAACTGCACTGATAACACATGCCATGAAAGATGGAACCAGCAGCAGCCACT
GCACTAGAGTCCCCGGATCCAAATAATATACACACATTTTAGGCAAGCATAAACCAAGAGAAAGCAGAAATAGTTGTCAGCGAAGCTCCAGAACACAGTG
ATGACGACGTCATACATTTTGGCCAGGTAGAGTCACTGCGTTTAGGCCTTTAGGGTAAAGTAATGCGACAGAGCAGAGTGTGCGGTGAGGAAACATAGCC
TAATGGCTACCAACAAGAGAAAGCAGGAATGTCCGATAACCGCCTGATGTTTCGGAATGGATAGCATCAGCTAAAGGCTTTTTGTATTTCTTGTAATATT
CTGCCTTGATATACTGCATATCAATCTCAGTCCTTGTTACCACAACCCTTACAAGTGTCTTGTCATCAGTACCTAGACCTTTCATGGACTTCCTCAACAC
CTTAGCAAAATACTTCGCTGGATTCTCAGCACATCTGAGGATAGTTAACAGAGCAACTTCAAAGTTTCCAGATGTTTCATTCTTCACAACCTTCTGTAAC
GACCGATCATACATGTGATGGTAAGCAGAAGCAACAGCTGCCATGTGTGCCCAGCTGCGTTCAGTGAAGATGCGGATGAAGGTTTTCTCATCTGTGCCCA
GCTTTTTCTCACCAGCTTTGTAGAGGTCCTTCGCATCATGTGTCACTATAGTGGGATCAACCTCCGGGCCTTCGTAGCGTGGAATGCCAACATAGGCTAG
TAAGATCTTCTGATGATCGCCGGATGCTTGCTGACTAATGTCATGCTCAAGATAAGTACCAAACTTTGCATAATATGTCTGTTTCATTATTTGCAGCTGT
GATGGTGTCCTGGAACATATTATATCAGTAGCTGCTTTCAGATCAAGACTTTCAGCACTTAGAGCTTCTTTCAGAACAGTCGCATCACGTCCAGCAGGAT
CAAGAATCCAGAGCGACATTGCTTTCTTGTGGTTTCCACTGAGTTCAGACGATATACGACGTGAAAGTTCCTCAGAATACATAGTTTTGTATTCCTGTTG
AATGTATCCACGTTGCATTGAGTCACGGTGAGCAAGTATATTTGAAACTGTTGTACTATCACAGCCAAACCCTTTGAAGGCCTTGTGGAGGTCGATGGCG
TCCTGGCGGGGGTTCGGGGGCGCCGGCGGCAAGGTGAGGCTCGCCATTGCCGACCGAGTTCGATGCGCGCTTCCGCCTCCGGCGATTCGATTGGATTGGA
TTCG
page-top