Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14236  (registered. 2012)
Contig Information
Length 902 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115435592|ref|NP_001042554.1|| Os01g0242300 [Oryza sativa (japonica cultivar-group)]
Score 249
Evalue 4.00E-64
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14236
ACAAAAAATAGAATCAGGTGAAACAAACCGTTTCATTCTGACTTGCTATCAGTCTCTCACAATGGATCACCGACATACTACATGGTTGAGGAGAAATTTT
GGATAATAATCTGTTGGGAGCCCACAGCACAATCGCACTTCTCACTTATGTGTTAGCGAGCCAAAAAAGGCCCAAAGTAAGAATACATTCATCTTTATAT
CTTGTTCGGTGGTCACTTACCCAGAAGTAACAGGGCTTTTTCCTCACACAATCACACTATTATTTCATCAGGATGTCTAATGGATCAACCACCATAAAAT
TTGATCCATTCACCCAAAGAATGGGCATGGCTACAGTATCAAAGAACTGCGACAGAAGAAACCAATTAGCTAATTTCGAGGTGCTTTGTGCATAAACTCC
ACAACACAACATTCCCCTTTCTCCTGACGAAAGTTGAATCGATAAATCAAGCAGGTGTTGCTTCCTTGCTGCTATCTGCTGCATTGACACCTTTGAAGTT
CAATATTCCAGAAAGGCCCCGGCCTTTGGCGAGGCGCTCAAGTTCAGCCAGCTTCACCTTGAGATCTTCTAAATCTTTAGCTAGAATCTCTTCCTTTTGT
CTCAGTTCCTCAAGTTCCTGTTTACGAGCTTCCTCCTTTCTAGCCTCTGACCTAGCACTTCTTTGCACCTCGAAAATTAAAGCGGCGACAGCAACCGAAA
AGATGAAGCCTTCTCCAATGAGATCTGTAGCAGCTTGTACTGCCTTCTCCTCATCTAAAGGTCTGATAGCCACATTAGTAGCATGCCCGTAAATGCGTCT
TTGTATCCTTGTAGTGATACGATGGTTTGTCTGGGCGATGCTGATGATGAAGTCACGAAACTTGGGGTGGACGGCGGCCTGGCTCTTGAGGCGGTTGGCG
AT
page-top