Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14234  (registered. 2012)
Contig Information
Length 927 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_EMI Dormant seed with water absorption after breaking 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242091738|ref|XP_002436359.1|| hypothetical protein SORBIDRAFT_10g001060 [Sorghum bicolor]
Score 311
Evalue 9.00E-83
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14234
CCTTCTACTGTTGGCCAAAGAGAAAGTAGAAAAAATTGCCAAAATTTGGCAAGGCAAACATGGACAAAAATTGACATCAATCTAAGCTGGTGCAGAGCAT
TTTGATTTCTCCAGCTGCATGAACCCCAAACAGATCCATCACCATCAGCTCAGAACCAAATGGTATCACAAGGCAGCCATGTGTTTTCCCTTGAGCTATA
TCTATCACCAAATTTTTACCACTACACAACAACGGTCCACTCTGAAACAAGCTGTATGTATAAACGCTGGCTTAGCTAACACAGCAACGGCGGCAGCACT
GTACAACTAGCAGCAACAGCCTATGCGCCGCTCCCTGGTCGCTGGTCGGCGGCGGGATGTTGCTGCCAATCCTGTTCGACGAGGCGGGAGGAGCTGAGCT
CGGTGGTGCTGTAGAAGGACTCGTCCGGGCAGAATCCCCCGTACTCCTTCTCGTCCTCCCACCGCAGCACCTCCCTGATGTACCGGAAGGCCTCGTCGAC
GGTGGGGCCGTCGCGGGCGCGCGCCTGCCACACAAAGAGCTTCCGGTCGCCCGTGTGCGCCGCGTACAGGTTCTTGAACTTCATCGCCACGTAGAAGAAG
GCCTGCTGCGCCATCGACTGGTTGTTGTGGGTGCGGAGCGGGTCGAAGTCGCTGAACCACTCGCAGGCGGTCAGCGGGGACCGCCCGATCTTCTCCTCGA
AGATGTCGAACTTGTTGAGCACCAGGACGAATGGTGTGTCGCGGAAAGACGGGTGCCTGATTGTGGCCTCAAACAAGTCCCTGCTCTGAATCATCTTATT
CTCGAGGCGCCTACTGCTGCCACTGGCANNGGCTCCCAGCTGGTCATAGTCACTGAGTGCTATAGAGAATATAACAGCGCGGNNNTCCTCAAACATTTCA
ACCCATTTGCAGCCCTCATTCAAGCCC
page-top