Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14233  (registered. 2012)
Contig Information
Length 1135 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242080553|ref|XP_002445045.1|| hypothetical protein SORBIDRAFT_07g003330 [Sorghum bicolor]
Score 490
Evalue 1.00E-136
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14233
ATTCCTGCTTTTATTCATGTAATATCACTAATAAAATGCTAGTGTTTATTCTGTCAACTGTCTATAACAACAATGCGACTCCCAAAAGAATAATTATTAG
CTTAAACAACTTGGATCACGCCTACTGCATTCCGGGAAGAAATGTTGTTGGTCATGTTTTGTTGGGAGGGCAGGCCAACCGTCAGCTCCAGATCCTTGTT
CTCTGCTGCATGATCTGTCTTCGCAGCCGTCGCAGGAGGCAATGGTGAAGGACCGCTTTGCGGGATCAGGAATGCGCTAGTACATGAAGTCAGGTTAGCT
TCAAATGTCAGGGCACTTGTGTTGGCAGTCGCGGGAGCTGATGGAGGTGTCCCTTCAGGGACTATTGGAATTGGTCTGAACAGCGAGGGTACCCGCGAGA
AGCAATCCATGTGGTTCATTTTGCTGAGACTTCCATCCACATTTGTTGCCGTAAAAGATGGAACTGGGGGAGGAAGATCTCTTGTAACTTGTTTTGCTAG
ATTAGCTGCATTCGAAGATGATACTCCTTCCAAGCTGCTGTTCTGGAGTTGATTAGTCATAGTTACCATATCATGAAATTTTGCCATTGTTGGTGGTAAG
ATGGGGCAATTTGGTGCTGGTGACAAATCGCTTGCCATCATATCGAAAAGGCTAGACCTGCGCTTCTTCTTGTTTGGATTAGTTTGTCTGAGAAAATATT
TCTGAGCATGACTGGCCACTTGAGTTGGTGTCCTGGTAGTAACGAAATTTTTTGCTATACCCCTCCAGTCTCCCTTCCCCAGCTTTTCGAGACCAGCAAG
AAATGTCCTATGCTCTTCTTCAGTCCAAGGGACAGCTTTCTTTCTCTCCTGCGCCCTCCGCCGCTTGCCGGACGACTGCAGAAGGCCGCCGTCGGAGAGG
TACCCGTCGCCCGCGCCTCCAGCGTCCCCGGAGGGGCAGGCTGAGGCGAGGGCGGCCAGGTTGCCCATGCTCTTGCACTTGCGCATCACGTCCTCCCTCG
CCGCCACCGGTGGGTTGGGGCTCGGATCCCGGTCACCGTCCGGGGGATCCAACTGCGGCGCCGGCGCCGGCGCAATGGTGACGCCGAAGAGGCGCATCCC
TGGCGGGCGCGAATCTTGAGGCATCCCGGCGGCCG
page-top