Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14198  (registered. 2012)
Contig Information
Length 858 bp
Clones alternative view 57 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 6
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 6
WH_XA Root 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1568639|gb|AAB67990.1|| Cu/Zn superoxide dismutase [Triticum aestivum]
Score 400
Evalue 1.00E-109
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14198
ATATAATTCCTTAGCATTTTATAGCTTACGCACACCAAAATTCCCAAGTTCACGCTTCATAGCTCAACAAGACGAAAGTGTGCAAACATTTATTTGATAA
ACTCAACTTTACACTGATACAAACGATCAACAGAAACTATTAAGCATCCGATATTTGAAATCCAGGTAAAACGAGAATGGCGTCGTTACAAGTATGACTA
GAGATGCAAAACCAGAGATGGAAACCAGCGACCTACAACGGGGTCAGGCCAACAACACCACATGCAAGTCTTCCACCAGCATTTCCAGTACTGAGGCTGA
GCTCATGCCCACCTTTTCCCAAGTCATCTTCAAGCTCATGAACAACAAACGCTCTCCCAACAACTGCATTAGGGCCAGTCAAAGGAATCTGGCTATCGAC
AATGGTTGTCTCCGCCACACCTTCAGCATTGGCAACAATGTTTCCCAGGTCACCCGCATGACGGACTTCATCTTCTGGTGCACCATGTGTCAGGCCGTTT
GGGTTAAAATGTGGACCTGTTGATATGCACCCATTAGTCATGTCACCGAACTCATGGAGGTGGAAGCCATGAAGTCCAGGAGCAAGTCCAGTGATACGAA
CGTTCACCGTCGTGGGACCGTCGTCTTCCTGGGTGAGCGTGACGACGCCCTCGACCTGGGAGGTGCCCTTGAGCACCGCGACTGCCTTCTTGGTGGCGTC
GGCGACGACGAGCGCCCTGGCGGCGGCGGTGGCGCCTCCTGGAGTGGAGACAATTCGGAGCGACTGGAAAGGGCGGGCAGAGGCAGGAACCTGGAAGAGA
GGCGCGGCGGCGGCAAAGAGGAGGCTCTGCGCGGCCATGGCGGTCGTCGGGAGCGGAA
page-top