Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14171  (registered. 2012)
Contig Information
Length 466 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115435908|ref|NP_001042712.1|| Os01g0273000 [Oryza sativa (japonica cultivar-group)]
Score 150
Evalue 5.00E-35
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14171
ACATGCAGTACGGTACAAAGTCTGATACACAGTACTGAAACGAAGATAAGTATCACAGCTTGATATTGCTAGGGAAGTATCGCNGGTTCAGAGAGCAGTG
GCCACACAGTGCCTGATCGAAGATAAAGTGTACTACAGCTTTGATATGGATGGGGAAGTAGTTCAGCTCTTCTGAGTGTTGCCTCCCTCCAGCTCTTTCC
TCAGCTGCAGTGAGAAATCGTCATTCACGTCGTCGTCATCCCAGTCATCCTCCCATTGCTGGACAGCTTCGTTGCCATCTTCCTTGTCATCCCATTCTTG
GTCGATCTCGAACTCCTCGAACTCGTCGTCGTCCTCGAGGAGATCCATCTTGGCGGCTTCCGCCTTCGCGTCCGCCGGTGCTGCCGCCGCCATCGATGCT
GGTTCTAGTATCTAGCTGATTCGCGTGGAGAAGAAGAAAGGGGGAACCCTAGACCTGGCCTCGTGC
page-top