Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14167  (registered. 2012)
Contig Information
Length 715 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XE Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242048234|ref|XP_002461863.1|| hypothetical protein SORBIDRAFT_02g009510 [Sorghum bicolor]
Score 395
Evalue 2.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14167
AACGAAACACGGCGAGGCCGGCGATGGATGTCAAGTGCCGGCGTCTGGAGGGGAAGGTGGCCGTCGTGACGGCTTCCACGCAGGGCATCGGCCTCGCCAT
CGCCGAGCGCCTCGGCCTGGAGGGCGCCGCGGTCGTCATCTCCTCCCGCAAGCAGAAAAACGTGGACGAGGCGGTGGAGGGCCTCAGGGCAAAGGGGATC
ACCGTTGTCGGGGCCGTCTGCCACGTCTCCAACGCCGAGCAGCGCAAGCACCTCGTCGACACGGCCGTCAAGAATTTCGGACATATTGATATTGTTGTCT
CCAATGCCGCTGCAAATCCTTCTGTGGATAGCATACTAGAGATGAAAGAGTCAGTTCTTGACAAGCTATGGGATATTAATGTCAAAGCTTCTATTCTTCT
ACTTCAGGACGCCGCACCACATTTGAGGAAGGGATCATCTGTGATACTAATTTCTTCAATTGCTGGCTATAATCCTGATGCAGCTTTAACGATGTATGGT
GTTACAAAGACTGCCCTTTTTGGTCTCACGAAGGCTCTTGCTACTGAGATGGGCCCAAATACCCGTGTTAACTGTATAGCTCCTGGGTTTGTTCCTACAC
GTTTTGCTGGTTTCCTCACAACTAATGAGACCATTAGAAATGAACTTATCGAGAGGAGCATACTTAAGAGNTTGGGTAGTGTGGAAGACATGGCTTCAGC
CGCCGCTTTCCTGGC
page-top