Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14166  (registered. 2012)
Contig Information
Length 544 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_EMI Dormant seed with water absorption after breaking 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218196310|gb|EEC78737.1|| hypothetical protein OsI_18944 [Oryza sativa Indica Group]
Score 211
Evalue 2.00E-53
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14166
TCACACTACACTGATGAGTTCAAGACATGGAGTTAAATCCCATTGTCATCACACCCTATAGCCTGCATCACACTACACTGATGAGTTCAAGACACTGCGA
AAAGTCACGGCAACCATGTGCCACCGGCCATCACAACAGCAAAGTTCATCCACCACCACCAGGATAACAAAATGTACAGCAGGGGCCAGGTTTAGCATCT
CCGGAGCAGCTCACAGCGGCCCGAGGAAATCACCAGCCAGCGACGCAAGGAGCTGGAACTGGCGGTCTGCCTCCATCCAGCGGAACCCCATGACCTTGAA
GCGCACAGCGGTGTCCCTCTCCAGCTTCGAGTGGTCATTCATGAACATGGGGTTCTCGCCGCCCATGTACTTGTAGTCGCTCATCGATTTCTCCGACAGG
AAGATGCTTTCAATCGGCCCCGATTTGAGGAAGACACCGTGCTTGAGGATCTTCTCCACGGAGCCGACCAAGATCTCCCCCTTCATAGGCCTCTGGGTGA
TGCAGGTGAATGTGACCGGGAAAAGAACGTCTCCGGTCAGCTCA
page-top