Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14164  (registered. 2012)
Contig Information
Length 1093 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 1
Wh_V4816 Shoot grown under cold condition for 16days 8
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 5
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|285014508|gb|ADC33136.1|| ATP synthase subunit [Triticum aestivum]
Score 627
Evalue 7.00E-178
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14164
TCTTTCCCTCCCTTCCATCCTTTCTTCCCCTCCGCCTCCGCCTCTGCGGCCGCCAGTGACGCGCCAGGCGCTAGCTAGCCATGTCGTGCTCCCACCTCTC
CACCGCGTGGTCCTCCTCCGCGCTTGCCAGCACCTCCACCCGCCGCCGCGCCTCCACCGGCAGCAGCAGCCTGGTGGTGCGGTGCTCCCTCCGGGACCTC
CGTAACCGCATCGACTCTGTCCGCAACACGCAGAAGATCACGGAGGCGATGAAGCTGGTGGCCGCCGCCAAGGTCCGTCGCGCGCAGGAGGCCGTGGTCT
CCTCTCGCCCCTTCTCGGAGGCTCTGGTGGAGGTGCTCTACAACATGAACCAGGAGATCCAGTCGGAGGACATCGACCTGCCCCTCACCCGCCAGCGCGC
CGTCAAGCGCGTCGCGATCGTCGTCCTCACCGGCGAGCGTGGTCTCTGCGGCGCCTTCAACAACAACGTGCTCAAGAAGGCCGAGGCCCGCATGGAGGAC
CTCAGGCAGCTGGGCGTCGACTACACCGTCATCAGCGTCGGCAAGAAGGGCAACGCCTACTTCCAGCGCCGCGACTACATCCCCACCGAGCGCTTCCTCG
AGCTCGCCGGGATCCCCACCGTCAAGGACTCGCAGGCCATTTGCGACCTCATCTATTCCCTCTTTGTCGCCGAGGAGGTCGACAAGGTGGAGCTCGTCTA
CTCCAAGTTCGTCAACCTCGTCCGCTCCGACCCCATCATCCAGACGCTGCTGCCCATGTCCCCTAAGGGCGAGATCTGCGATGTCAACGGCATCTGTGTC
GACGCCACCGAGGACGAGCTCTTCAAGCTCACCACCAAGGAAGGCAAGCTCACCGTGGAGCGCGAGAAGATCAAGATCGAGATGCAGCCCTTCTCCCCCG
TCGTCCAGTTCGAGCAGGACCCCGTCCAGATCCTCGACGCTCTCCTCCCGCTCTACCTCAACAGCCAGATCCTGCGTGCCCTCCAGGAGTCGCTCGCTAG
CGAGCTCGCCGCNNNNNTGAGCGCCATGAGCAGCGCCACAGACAATGCCATCGANNTCCGGAAAAATCTCTCCATGGTCTACAACCGCCGACG
page-top