Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14148  (registered. 2012)
Contig Information
Length 859 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_SHDr Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242059265|ref|XP_002458778.1|| hypothetical protein SORBIDRAFT_03g040140 [Sorghum bicolor]
Score 372
Evalue 2.00E-101
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14148
AGACCCAGAGAATCAAGAGGAGATGCTTACTCTTCACACCGTTCAGACATCCCTTCCCTCGCCGCGCAGATCCTCTCTGCGCCAACATGCCCTGCAACTA
AGCAGGAGATTTTCCATCTGTAAGAGCAGCTCCGAAGATGCTGGATCCGATGCTCCCCTGCCGCACGGCGGTGACCAACGCCAGCAGGAGGTGCTTGCGA
AAATCGCCATGCTTCAGACGCAGAAGGTCCGCATCACAAACTTCCTGGATGAGCGGTCTGCTTACCTGACCAAGTTCACCAAGGACGCCGACACCGAGTT
TGATATGATTGGGCAGAACGCCATGAAAGAGCTCGATCAAATTGGGGACCAGATAATGGAGCGTCTTGACAGCAAGATGCAGTCCTACGAGGAGACAGCT
GAAATGCAAAGGCAGGAGATAGAAATGAACGAGAGGGTGTTAGAAGACTTCGAAGATTGGATTGAAGAGGAGAAAAACGAAGGCATGTTCTTCAAAAGCC
TTGGGAAGGTCCAAAAACCTCAAAACAATGAGGAAATCAAGGTGAAGGCTAGGATCGAAGCACAGAAGGTCACAGAGATAACAAAGGAGAGTGCAGGGTC
AAAAGCTCGGATGAATATTTACCTTGCACTGATGGCGATACTCAGTCTTACAATCGCAAATGCCGTCTTTGCAACGCCAGAGGTGGAATGGAGNNNNNTT
GCTGCTCTGGGTTTAATTTTCATTGGCCTGGTTGCTCANNTCATCTATGAGAAAGATATATCCCCACCAGCAGCTGACAAGAATGAAAAAAAAAAAGNNN
NNNNNNGCTGTGCACCGAGTGAAACATCAAAAAGCAGCAAGAGCTTCATCGATATAGAT
page-top