Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14137  (registered. 2012)
Contig Information
Length 950 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115439407|ref|NP_001043983.1|| Os01g0700100 [Oryza sativa (japonica cultivar-group)]
Score 380
Evalue 1.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14137
AATTGAAATATTTGTGTGGAGAAACATTTCATAACAAAGGGGGAGTCAAACAAAATATCCCCCCTCTGCATTCTTTGGGAAAAGAATGATATACTTGAGC
AACATATAAACAGAGGCGTAGGCCAGCAAATCTGTACAAACTGATTCAGCATCAACTAGGGAAAACAGGGCCCGGGCATACAATTCTCTCCCACAGAACC
CCACACCCAACCTTTCTAGCCAAGCTAAAACTGAGAATTGATCACTTGAGCTTTGATCAGGCAAGCAACGGCGCAGACGTATCCTTGCATCTCCATTTGC
GGCTGTAGTAAGCGTAGAGCGTCAACTGCGTTGCTCCCAGGACAACTCCAAGCCCGTTGGGCAGGTAGATGAAGAGATCACGCAGCAGCACTCCGTATGC
CGCGAAAGAGGCGCTCATCAGCAGCGTAGAGAGCGAGAGGTAGAAGGGCATGAACTCCACGCACTCCGTCCTGATCACCACTCCCATGACGGCCAGCGGG
GAAGCAAACATGCAGATGAGCGACGCCATGCTCACGGCGCCGACGAACTGCTGCCGAGTCGGCTGGTCGAAGAAGGCGATGCTCGCGTGCGCGACGAGGG
CGAACGCGCAGACCAGGAGAACCAGGAGCCCTACCATCCTCAGCCTGGTCTTTCTGCTGTCGGCGTAGATGAAGAAGAGAGAAATGTAGGCGAGCTGGAA
CGCGGCGCCGGTGCCGTTGACGGTGGCGACGAGCAGCCGGCCATCGGAGACCCAGGGGAGGCCATACCAGAGGCAGATGAAGCAGTTGAGCAGGGAGAGC
AGGTAGGGGAGCCCGTCGAACTGCTCCGTGGACTTGGCCTTCAGGATCCTCTTGAAGGTCGGCACTGGGGACAGGAAGAGAGCGAAGGCGAAGAGGTTGC
CGGCAAAGCCAGCGGCGAAGCAGGAGATCTCGTACAGGGAGAGGGAGTCC
page-top