Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14091  (registered. 2012)
Contig Information
Length 1208 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
WH_XI Two-week old seedlingsi22 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 6
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 6
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115462115|ref|NP_001054657.1|| Os05g0149400 [Oryza sativa (japonica cultivar-group)]
Score 552
Evalue 3.00E-155
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14091
CGGCACGAGGGATAACAACCATCTCATTGTAGAGAGATCAGACCAGAGCCTACCTAGCTACTCACTCATCTTCGTCAAGAACTTCACCATGGTTGTCCCG
GTCATCGACTTCTCCAAGCTCGACGGCGCCGAGAGGGCCGAGACCATGGCGCAGATCGCCGACGGCTGCGAGAACTGGGGCTTCTTCCAGCTGGTGAACC
ACGGCATCCCGCTGGAGCTTCTTGACCGCGTCAAGAAGGTGTGCTCCGAGAGCTACCGCCTCCGGGAGGCCGCGTTCCGGTCGTCCGAGCCGGTGCAGAC
GCTGGAGAGGCTGGTGGAGGCGGAGCGGCGCGGCGAGGCGGTGGCGCCGGTGGACGACATGGACTGGGAGGACATCTTCTACCTCCACGACGACAACCAG
TGGCCCTCCGACCCGCCGGCCTTCAAGGAGACCATGCGGGAGTACCGCGCCGAGCTCAAGAAGCTCGCGGAGCGGGTCATGGAGGCCATGGACGAGAACC
TCGGCCTGGACAAGGGCCGCATGAAGGCCGCCTTCACTGGAGACGGCCTCCACGCGCCATTCTTCGGCACCAAGGTCAGCCACTACCCGCCGTGCCCGCG
CCCGGACCTCATCACCGGGCTCCGCGCGCACACCGACGCCGGCGGCGTCATCCTGCTGTTCCAGGACGACAAGGTAGGCGGCCTCGAGGTACTCAAGGAC
GGCGAGTGGCTCGACGTGCAGCCGCTCCCCGACGCCATCGTCGTCAACACCGGCGACCAAGTGGAGGTGCTCAGCAACGGCCGCTACCGCAGCGCGTGGC
ACCGCGTCCTGCCCATGCGCAACGGCAACCGCCGCTCCATCGCGTCTTTCTACAACCCGGCGTTCGAGGCGGCCATCTCGCCGGCGGTGGGCGAAGGCGC
CGCCGCCGCGTACCCGGACTACGTGTTCGGGGATTACATGGACGTGTACAACAAGCAGAAGTTCGATGCCAAGGAGCCAAGGTTCGAGGCCGTCAAGGCG
CCAAAGTCAGCTTAAGGCTTAAGCTCAATCAAGGAGATTAAAAAGGAAATTATTTACCTATTAGCTGGCTTTTGTTTTACAATGAAGAAAAAAAATGTAT
TTTTGAGTTTGCTCAGACGCGTAGCAGTATGATGTGGGGATACTTGTGATTGGTTCGGTGTCAAATAATTAGGAAATGAAATATGGATTTTTCGTTGGAA
AAAAAAAA
page-top