Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14062  (registered. 2012)
Contig Information
Length 1324 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_OKCS Seed DPA5 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 1
WH_XE Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242036307|ref|XP_002465548.1|| hypothetical protein SORBIDRAFT_01g040920 [Sorghum bicolor]
Score 659
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14062
CATATATGCCTAGTTTACAACATGGAAATTAGTCAAATGTACAGCACAACTGATCATCACTAACCACAGCGTTTACAAAATTTTCACTAGCAGGTATGGG
CGACAACAACATATGGAACTCATGAAATCCAGAAATGTACATAACTGTTATGTACATTTACCAAACACGCAATCAGCCTTTAGTGTACACACGGCGTCAA
AAACCTCCAAGCCCTCGTCATATTGGAAGGGAAACCAGGCTCAAACGTGATCTGAAAGAACCGACGCGGAAATCCTCTTCAAGGATGAACACGCTTTGGA
GATGTCCGATTCAGTGTGACCAGCTGAAACGAACAGCCGGATTCCGACGGGGAGCTTGCATCTGTCCAGAGTTGACCTCTTCGAGGCCACAATGAAAACT
GAATCTTCCTTCAAAACCTGCTCGGCAATGGTTTCAAGAAGATCTAGGTCAGTGGCCAGAGAACCCGTCGATTTCTTCAGCTTAAGGAAGACGATCGGTG
ACAGGACATGGCTAGAAATCTCAAGTCCTGGTGTATCTGACAGTCCTGTATGCAGAAGAGCAACATTGCTCCTTAGGTTAGCGAGAACTGAAGGATTCTC
CTCCAGGTAGTTTACAGCAGAAACTGCGGCACTTGCAAGATAGGGTGGCAGAGAGGCAGAGAAAACATAGCCAGCGCTGCTTAGACGCTGATGATCAACA
ACTCTGGCACTTCCTGTACAGAAGCCACCATCAGTAGCTAATGCATTTCCCATTCCGGCAGTGATGATATCAATTTTGTCAATCGGTACACCATAATGTT
CGGCAAGGCCCCGCCCAGACTTGCCAAGCACACCAAACGAATGACTCTCCTCCAGAATTACACGGAACAGATATTTCTCCTTCAATTTGACTATCTCATC
CAAGGGGGCGATTTGACCAGAATTCTGGTAGATAGATTCCACAACAATGTAGCGTCTAATCTTCTCGGTACGTTTGTTTCCGCGAGTAAGTTTTTCCAAA
GTGCTAGCGAGTGAAGCCATATCATTGTGCTTGAAATAAACAACAGTACTTCTCGATAGATAGAGACCATTTTGCACTGCCCAGTGAACACCCTCATCAG
CCACTATGATATCTCCTTTCTTACAAAAGGCAGGTATAACACTGAATATGGTAGATATCCCATACGAATACAGAATGGAGTCCGGTGTTCCCAGGAAATT
GGCTATTTTTGCTTCACAGTCAAGGTGGACATCAATTGTTCCATAGAAGCCACGTGGACCACAGGATCCAACACCATATTTCTCCAATGAACCAACACAA
GAATCAATAAGTTTCTCGTTGCCA
page-top