Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14061  (registered. 2012)
Contig Information
Length 882 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 6
WH_XV Leaves, plant was grown at constant 23Ž 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242347655|gb|ACS92632.1|| putative PEX11-1 protein [Triticum aestivum]
Score 439
Evalue 2.00E-121
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14061
AGGCAGCCCCGTCCGTCCCTCCACGGCTCATCTCCTCTCAGTCCACACAAAATCGGATGGTGAAGCAGCAGTAGCAGCCGGAGAAGCAGTTCCCCTCCCC
TCCCCAGCAGCTAAGCACCAGCCGGCCGGACCCGCCCCTTCTCCACCCTCCTCCCCTCTCCCCGCTCCGTCATTACCAAGGAAGGAAGATGGGCTCGTTG
GAGGCGACGCGGGCGGAGCTGGGGCTGGCGGTGCTGTACCTGAACAAGGCGGAGGCTCGGGACAAGATCTGCAGGGCCATCCAGTACGGCTCCAAGTTCA
TCAGCAACGGCCAGCCCGGCACCGCGCAGAACGTCGACAAGTCCACCACCTTGGCTCGCAAGGTCTTCCGCCTCCTCAAGTGGGTGAACGATCTGCACGC
CCTCATCAGCCCGGCCGCCAAAGGGACCCCTCTCACGCTGGTCTTGCTTGGGAAGTCCAAGAATGCGCTGCTGTCGACTTTCCTGTTCCTGGACCAGTTC
GTGTGGCTAGGAAGATCGGGGATTTACCAGAACAAGGAGCGCACGGACCGCATCGCCAGGATGTCCCTCTACTGCTGGATGGCCTCCTCCGTCTGTGCAA
GTCTAGTCGAGCTTGGTGAGCTCAAGAGACTATCAAAGGCGATGAGGAAGCGCGCCAAGGAGCTTAGGGGCGCCGACAAATACGAGGACGAGCAGTACCT
GGGGAAGATGAAGCAGTCGGACGACCGGCTGCTGGCGCTGGTGAAGGCGGGCATGGACGTGGTGGTGGCCGTGGGGCTGCTGCAGCTGGCGCCCAAGAAG
ATCACCCCCNNNNTCACCGGGGCCTTCGGCTTCGTCACCTCCCTCATCTCCTGCTACCAGCAACTCCCGTCCCGCGCTCCCC
page-top