Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14058  (registered. 2012)
Contig Information
Length 886 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115488340|ref|NP_001066657.1|| Os12g0420200 [Oryza sativa (japonica cultivar-group)]
Score 529
Evalue 2.00E-148
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14058
ATGCAGAGTATGCAGAGTTCTCTTCCAAGGTGCTGCATTTGAAAGGTGATAGGAAAGACTTTGATTTCGTGAAAACCAGCCTTGCTGCTAAGGGCTTCAA
CGTCGTCTATGATATTAATGGGCGTGAGGCCACTGAAGTATCCCCCATACTAGAAGCGTTGCCGAACCTGGAACAGTTTATCTATTGCTCATCGGCAGGA
GTCTACCTTAAATCAGACCTGCTCCCACACTTTGAGACCGACGCCGTGGACCCGAAAAGCCGGCACAAGGGAAAGCTGGAGACGGAGAGCCTGCTGGAGA
CGAGCGGCGTGAACTGGACGTCCATCAGGCCGGTGTACATCTACGGCCCTCTCAACTACAACCCCGTGGAGGAGTGGTTCTTCCACCGGCTCAAGGCTGG
TCGCCCGATCCCCATCCCTAACGCCGGGAACCAGATCACCCAGCTCGGCCACGTCAAGGATTTGGCGACGGCCTTCATCAAGGTCCTCGGCAACCCCAAG
GCGAGCAAGCAGGTGTACAACATCTCTGGCAGCAAGTACGTCACCTTCGACGGGCTAGCACGGGCATGCGCAAAGGCTGGAGGGTTCCCTGAGCCGGAGA
TCATCCACTACAACCCCAAGGACTTCGATTTCGGCAAGAAGAAGGCCTTCCCCTTCAGAGACCAGCATTTCTTCGCGTCGGTGGAGAAGGCCAGCAAGGA
CCTCGGGGTTACACCGGAGTACGACCTCCTCGACGGCTTGACGGATTCCTACAACCTCGACTTCGGCCGCGGGACCTTCAGGAAGGANNCCGACTTCACC
ACGGACGACATGATCCTTGGCAAGAAGCTCGTGAGCGTGTGAGCCGATCTGNNNCGTGCATGGACGGACACATGGCTCATGGCAGC
page-top