Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14  (registered. 2012)
Contig Information
Length 769 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|6958202|gb|AAF32491.1|AF091837_1|AF091837_1 DNA-binding protein [Triticum aestivum]
Score 416
Evalue 2.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig14
AAAGAAGGATGATGTTGAGCGGATGTGGCAGGTTTGCGAGGCCAANNNNNNTCTAGATGAGTGCTTGTCTGCTATAGAATCTTTTGGTAGGCTTGGAGAC
GTTGAACGGGCGGAGAAAGTCTTTGAGGATATGTTTGCGACATGGAAAACACTCTCCTCCAAATTCTACAATGCTTTGATGAAGGTGTATGCTGATCAAA
ACCTTTTCGAGAAGGGTAAGGAGCTAGCAAAGCGCATGGATGAGGATGGTTGCAGACTAGGCATCTCAACAATTGATTCGCTGGTGAAGCTCTATGTGGG
CGCTGGAGAGGTGGACAAAGCTGAATCTATACTGCACAAGCTGTCTAAAAGTAACAAGATGAAGCCTCAGTACAGCTCATATCTCATGTTGCTTGATACT
TATTCAAAGAAAGGGGACATCCACAATTCAGAGAAGGTGTTTGACCAGTTGCGGCAGATGGGTTATAATGGGAGGGTTAGGCAGTACCAGTTGCTTCTAA
ATGCATACGTGCATGCAAAGACTCCTGTTTATGGATTTAGAGAGAGGATGAAGGCTGATAACATTTTCCCCAACAGTGTCATCGCGTCTTTACTTGCTGC
TACCGATCCATTCAACAAGAAGAAGACATTATCTGATATGCTCGAGTAGGATCTGGAATACCGTTAGGTTCATCCCGTTGCCATGCAACTGCTTCCGGGT
TTCTGCTAAAGTATATGATTGAGATAATAATGTTTTGGTCATGTAACGAACCACTAGTGTTTGTTTTGC
page-top