Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13996  (registered. 2012)
Contig Information
Length 1076 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125531097|gb|EAY77662.1|| hypothetical protein OsI_32701 [Oryza sativa Indica Group]
Score 404
Evalue 7.00E-111
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13996
ACCCAGACCTCCTCCCGGGAATCGGAACCGCGTCCCAGCCAGCCCCAACCCATTCGTCGCTCCCCTGATCCATCCGGCGACGCGGCGGAGCGAGGAACCA
AGGCTCGAGCAGCGGGCGGGCGGGCGGAGAGGAGCCGGAGAGATGGCGGAGAACCCGCAGCTGTTCGGGAACGGGATGCCCGTGCCCTTCCACGGCGAGA
TGTTCGTCCTCGCCCGCGACGGCGTCGAGTTCCACGTCGACAAGATCCCCTCGGCGCCCGGCGGTCACGCAAAAACAAAGGGCACCATATACCTGTCTAA
CATAAGGATGGTGTTTGTCGCCGCCAAGCCTGTTGGGAACTTCTTTGCCTTTGATATGCCCCTGCTGTACGTGCACGGTGAGAAGTTCAACCAACCGATA
TTTCACTGCAACAATATTTCTGGATTCGTTGAGCCGGTTGTTCCAGAGAGCCAGAACAGGGCTCTGTACTCGACCCACACCTTCAAGATCTTGTTCAAGG
AAGGTGGATGTGGTACCTTTGTGCCACTCTTCCTGAACCTGATAACATCAGTGCGGCGCTACAATCAGTTTGAAGCCCAGCCTGCTACTGTGCCCCGTGT
GGACCCCATGCAGGCAGCGCAAACTCCTGTCGACGACATGATGCGCCATGCGTATGTCGATCCACATGATCCTACCAAGATCTTCCTCCAGCAGCCCGCA
CCGGAATCCCAGCTGAGGAGGAGAAACTACCACGGCCCCGCGGACAACGCGTACTGATGCTTTGGCCTGATTGCGAAGTGCATGTGTTTTCGATGATCTA
TGTGGCGCACACGAGCAATATATCTGTTTGGTGTCATTCTGGTGATTCTCACTGAAGGATGTGATGGAAGTATAGTAGTGTGATGATGATGTCAGACAAT
TGTGTGCTTCACTGTTGGATTCAATCCAGATCTAAGTATAATAATGTACATACAAGGTGATCTGCTGGATTGTATGTTGCTGATCTCGTCGTATAGAGTT
AAGAATTGGTCTGAATGCTGAGTAAATTTGTGTCGACATGTTGAGATGTGTGCGTTTGTTGGGTCCATTCAGCCTC
page-top