Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13965  (registered. 2012)
Contig Information
Length 475 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig13965
TCACAGCATATATAATATCTAGCATACATCATAACATAATTTGCCAAGCTTAATTTAGTAGCAAGCAGTGGGTATAAGTAATGCAGGGAAGGTCAGGGCA
GGGCAGGGCAGGGAAACATATAATAAATGCATAACTGATCAAAAATCTCTTGCTTGATATATATAATCATTCATTCATTCAGTACTGCTACTCCATGAGG
ATGAGGGCATTCATACATATATACTGGTAAGGAGCTATATATGCATAGCATCTTAGCAAGTAGTAGTAGTAGTAGCAGTGATTCATCCATCTCTGCCTCT
GCCTCTGCCTAAAGCTTGGAAGATGGCAGGCATGTATATATCAGTTACCGAGTTGCTTGGCGTTAACGATGCTTGGGCAGGCAGGGGGCGGCGCCGCCTT
CTCGTCGAGNNNNNNCTCCACCGCGTTCGGGTTCCCCCACACCGGGTACCCCTTGATCTTACCAAGCACGTTCAG
page-top