Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13963  (registered. 2012)
Contig Information
Length 559 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|151935411|gb|ABS18744.1|| ubiqutin ligase-like protein [Oryza sativa Japonica Group]
Score 280
Evalue 6.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig13963
CCCCGAAACCAACACACATCATCAGGACTCATGGTCCATCAAACCAGATACAGTAGACTTAACACGAACAAGACACAGGACTAATAGCAGCAGGTCCAAC
GTCAGGGCAATTACTGACCACCACGGAGGCGGAGCACCAGGTGTAGGGTGGACTCCTTCTGGATGTTGTAATCAGCAAGAGTGCGGCCATCCTCCAGCTG
CTTGCCGGCAAAGATGAGGCGCTGCTGGTCCGGAGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCAATGGTGTCGGAGGATTCCACCTCA
AGTGTGATGGTCTTGCCGGTGAGGGTCTTGACGAAGATCTGCATGCCTCCCCTAAGGCGGAGGACAAGGTGCAGGGTGGACTCCTTCTGGATGTTGTAGT
CAGCAAGGGTGCGGCCATCCTCCAGCTGCTTGCCGGCAAAGATGAGGCGCTGCTGGTCCGGNNNNNTGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTT
GTCGATGGTGTCNNNNNNCTCCACCTCAAGGGTGATGGTCTTGCCAGTCAACGTCTTGA
page-top